Importance of duplex velocity histograms in the diagnosis of liver cirrhosis

Urea transporters are membrane proteins that mediate rapid, passive movement of urea across cell membranes. Physiological studies have revealed their significant roles in urea accumulation in the kidney inner medulla, and consequently in the urinary concentrating mechanism. Three mammalian urea transporters have been identified and their expression in the kidney was found to occur in a tissue-specific manner. This review discusses our current knowledge with emphasis on the localization and regulation of expression of urea transporters in different physiological conditions.     

Unstable association in vitro between donor and recipient DNA in Bacillus subtilis

In addition to stable donor-recipient DNA complexes, unstable complexes between donor and recipient DNA were formed in vitro with Bacillus subtilis. Whereas the stable complexes survived CsCl gradient centrifugation at pH 11.2 and phenol plus sodium p-aminosalicylate extraction with 0.17 M NaCl, the unstable complexes dissociated during these manipulations. The donor moiety from the unstable complexes remained associated with the recipient DNA during phenol plus sodium p-aminosalicylate treatment at 0.85 M NaCl. The unstable complexes could be stabilized artificially by cross-linking with 4,5',8-trimethylpsoralen. Dissociation of the complexes during CsCl gradient centrifugation could be prevented by centrifuging at pH 10. Heterologous DNA fragments derived from phage H1 DNA appeared to be unable to form complexes with the recipient B. subtilis DNA. Unstable complexes were also formed with Escherichia coli DNA, although under all conditions tested, more complex was detectable by using homologous B. subtilis DNA.     

DNA chain flexibility and the structure of chromatin nu-bodies

The persistence length of high-molecular-weight, monodisperse-bihelical DNA has been evaluated from low-shear flow birefingence and viscosity data at several temperatures in 2.0 M Nacl neutral pH buffer. At these solvent conditions, both the DNA and histone components of chromatin nu-bodies have structural features similar to those in the intact nucleohistone complex at low ionic strength. The theory of Landau and Lifshitz is used to relate the experimental result to the thermodynamic functions for bending 140 nucleotide pairs of DNA into a plausible model structure: per nu-body, delta Gb=43.8 +/- 5.3 kcal/mole, delta Hb= 45.7 +/- 3.7 kcal/mole, and delta Sb = 6.2 +/- 12.4 entropy units. This bending free energy is comparable to or less than that estimated to be required for a kinked DNA configuration and appears to be well within the range of estimated electrostatic free energies available from DNA-histone interactions in a nu-body assembly.     

An intercalated and thermally stable FAPY adduct of aflatoxin B1 in a DNA duplex: structural refinement from 1H NMR

The structure of a formamidopyrimidine (FAPY) adduct arising from imidazole ring opening of the initially formed trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 adduct under basic conditions and positioned in the 5'-d(CTATFAPYGATTCA)-3'*5'-d(TGAATCATAG)-3' oligodeoxynucleotide was determined. The FAPY adduct may be a major progenitor of aflatoxin B1-induced mutations in DNA. The freshly prepared sample showed biphasic melting, with transitions at 28 and 56 degreesC. NMR initially showed multiple subspectra. Over a period of several days at 4 degreesC, the sample converted to a single species with a Tm of 56 degreesC, 15 degrees C greater than the unmodified duplex. The deoxyribose was in the beta configuration about the anomeric carbon, evidenced by NOEs between FAPYG5 H3', H2', H2", and H1'. FAPY formation resulted in the loss of the guanine H8 proton, and the introduction of the formyl proton, which showed NOEs to FAPYG5 H1' and A6 N6Ha. A total of 31 NOEs from AFB1 to DNA protons were observed, mostly to the 5'-neighboring base, T4 in the modified strand. Sequential NOEs were interrupted between T4 and FAPYG5 in the modified strand, between C16 and A17 in the complementary strand, and between T4 N3H and FAPYG5 N1H. An NOE between FAPYG5 N1H and C16 N4H showed intact hydrogen bonding at FAPYG5*C16. Upfield chemical shifts were observed for T4 H6 and A17 H8. Molecular dynamics calculations converged with pairwise rmsd differences of <0.9 A. The sixth root residual was 8.7 x 10(-2). The AFB1 moiety intercalated from the major groove between FAPYG5 and T4*A17, and stacked with T4 and FAPYG5 and partially stacked with A17. The base step between T4*A17 and FAPYG5*C16 was increased from 3.4 to 7 A. The duplex unwound by about 15 degrees. The FAPY formyl group was positioned to form a hydrogen bond with A6 N6Ha. Strong stacking involving the AFB1 moiety, and this hydrogen bond explains the thermal stabilization of four base pairs by this adduct, and may be a significant factor in its processing.     

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.     

The impact of an exocyclic cytosine adduct on DNA duplex properties: significant thermodynamic consequences despite modest lesion-induced structural alterations

The exocyclic base adduct 3,N4-deoxyethenocytosine (epsilonC) is a common DNA lesion that can arise from carcinogen exposure and/or as a biproduct of cellular processes. We have examined the thermal and thermodynamic impact of this lesion on DNA duplex properties, as well as the structural alterations imparted by the lesion. For these studies, we used calorimetric and spectroscopic techniques to investigate a family of 13-mer DNA duplexes of the form (5'CGCATGNGTACGC3')x(3'GCGTACNCATGCG5'), where the central NxN base pair represents the four standard Watson-Crick base pairs (corresponding to four control duplexes), and where either one of the N bases has been replaced by epsilonC, yielding eight test duplexes. Studies on these 12 duplexes permit us to assess the impact of the epsilonC lesion as a function of sequence context. Our spectroscopic and calorimetric data allow us to reach the following conclusions: (i) The epsilonC lesion imparts a large penalty on duplex stability, with sequence context only modestly modulating the extent of this lesion-induced destabilization. This result contrasts with our recent studies of duplexes with abasic sites, where sequence context was found to be the predominant determinant of thermodynamic damage. (ii) For the epsilonC-containing duplexes, sequence context effects are most often observed in the enthalpic contribution to lesion-induced duplex destabilization. However, due to compensating entropies, the free energy changes associated with this lesion-induced duplex destablization are nearly independent of sequence context. (iii) Despite significant lesion-induced changes in duplex energetics, our spectroscopic probes detect only modest lesion-induced changes in duplex structure. In fact, the overall duplex maintains a global B-form conformation, in agreement with NMR structural data. We discuss possible interpretations of the apparent disparity between the severe thermodynamic and relatively mild structural impacts of the epsilonC lesion on duplex properties. We also note and discuss the implications of empirical correlations between biophysical and biological properties of lesion-containing duplexes.     

Importance of structural differences between complementary RNA molecules to control of replication of an IncB plasmid

Replication of the IncB miniplasmid pMU720 is dependent on the expression of repA, the gene encoding replication initiator protein RepA. Binding of a small antisense RNA (RNAI) to its complementary target (stem-loop I [SLI]) in the RepA mRNA prevents the participation of SLI in the formation of a pseudoknot that is an enhancer of translation of this mRNA. Thus, RNAI regulates the frequency of replication of pMU720 by controlling the efficiency of translation of the RepA mRNA. Mutational analysis of the two seven-base complementary sequences involved in formation of the pseudoknot showed that only the five central bases of each were critical for the formation of the pseudoknot. Physical analysis of SLI showed that despite the complete complementarity of its sequence to that of RNAI, the structures of the two molecules are different. The most prominent difference between the two structures is the presence of a 4-base internal loop immediately below the hairpin loop of SLI but not that of RNAI. Closure of this internal loop in SLI resulted in a 40-fold reduction in repA expression and loss of sensitivity of the residual expression to inhibition by RNAI. By contrast, repA expression was largely unaffected by the closure of a lower internal loop whose presence in SLI and RNAI is essential for effective interaction between these two molecules. These results suggest that the interaction of SLI with the distal pseudoknot bases is fundamentally different from the RNAI-SLI binding interaction and that the differences in structure between RNAI and SLI are necessary to allow SLI to be able to efficiently bind RNAI and to participate in pseudoknot formation.     

Isolation of circular viral and complementary strand DNA from bacteriophage f1 duplex replicative-form DNA

A general method has been developed for the large scale isolation of intact, circular, single-stranded DNA molecules of each strand from supercoiled duplex DNA. The method involves the conversion of the supercoiled duplex DNA to singly nicked, relaxed duplex DNA; denaturation of the duplex DNA; separation of circular DNA molecules from linear DNA molecules; and separation of circular plus and minus strands. All separations involve zone sedimentation. No isopycnic gradient centrifugation is required. The last step in the purification, the separation of plus and minus strands, can be easily adapted for small scale analytical measurements of the amounts of plus and minus strand DNA.     

Absence of association between a mitochondrial DNA mutation at nucleotide position 3243 and schizophrenia in Japanese

PURPOSE: To evaluate the effect that increased numbers of women medical school graduates have had on the composition of orthopedic surgery residencies, and to evaluate trends over time in the likelihood of women medical students to select orthopedic residencies. METHOD: The author analyzed JAMA's "Reports on Graduate and Undergraduate Medical Education" for the years 1977 to 1996, calculating the numbers of women and men in orthopedic surgery and other surgery residencies, and medical school composition. RESULTS: Although there have been modest gains in the number of women in orthopedic surgery training programs in the United States, women continue to choose orthopedics only one-seventh as often as do men. CONCLUSION: Orthopedics remains an unattractive career choice for women medical students compared with their men counterparts. Biases and stereotypes about women and about orthopedic surgery may account for this difference.     

Evidence for an association between the discriminative stimulus and the response-outcome association in instrumental learning.

In 4 experiments, rats received 1 of several outcomes for engaging in various instrumental responses in the presence of discriminative stimuli. Discriminative stimuli shared some response-outcome relations but not others. When a response was subsequently extinguished in the presence of 1 discriminative stimulus, that produced relatively more decrement in responding in other stimuli that shared the same response-outcome relation. Other discriminative stimuli, in the presence of which that response had been reinforced by other outcomes and in which the original outcome had reinforced another response, were less affected. Moreover, postextinction devaluation of that outcome suggested that the particular response-outcome relation extinguished had undergone decrement. These results suggest that discriminative stimuli have relatively specific associations with the response-outcome relations that obtain in their presence. (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

The association between daily stress and sexual activity.

Research has shown that stressors and experienced stress are negatively correlated with sexual activity (i.e., behavior and satisfaction) within couples. Thus far, most studies have been cross-sectional and report correlations only. This study is one of the first to examine the covariation between self-perceived stress and daily sexual activity within a time period of 3 months by collecting data on stress, sexual activity, sexual satisfaction, and sexual fulfillment as well as individual and dyadic coping. The association among these variables was tested in a multilevel model that included cyclical terms to capture the regular variation of sexual behavior over the days of the week. One hundred and three female students completed questionnaires and diaries 12 times during a 3-month period just prior to a major exam. Findings suggest that higher self-reported stress in daily life was associated with lower levels of sexual activity and satisfaction and a decrease in relationship satisfaction. In addition, dyadic coping was positively associated with sexual outcomes but did not moderate the association of experienced stress and sexuality. Implications for sexuality research in close relationships and methods for studying cyclical processes are discussed. (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

Refining the association between attributions and behavior in marital interaction.

Evidence in support of an association between attributions and behavior in marital interaction is incomplete and subject to alternative interpretations. To address this problem, 120 newlywed spouses completed measures of marital satisfaction and marital attributions and participated in 2 interaction tasks. In one task, spouses discussed a marital difficulty with their partner. In the other task, one spouse described a personal difficulty that he or she wanted to resolve while the partner provided support; these roles were then reversed. To the extent that wives offered maladaptive attributions, they tended to behave in ways that hindered problem resolution in both tasks. Attributions and behavior were more strongly related among wives than husbands and among relatively distressed spouses than nondistressed spouses. (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

Sex-specific association between psychopathic traits and electrodermal reactivity in children.

This study investigated the relationship of skin conductance response (SCR) to a child psychopathy measure. Blunted electrodermal activity is a theoretically important characteristic of psychopathy, but it has not been fully explored in preadolescents or females. The authors tested the hypothesis that reduced SCR magnitude is associated with psychopathic-like traits in boys and girls. Participants were drawn from an ethnically diverse community sample of 9- to 10-year-old twins. Given the fact that members of each twin pair were rated by the same individual (i.e., their caregiver) on the Child Psychopathy Scale, the authors examined individual differences at the within-family level. Skin conductance data were collected during a passive auditory task consisting of 75-dB tones as well as miscellaneous sounds (e.g., baby cries, bird noises, and speech-like stimuli). Reduced SCR magnitude (hyporeactivity) was characteristic only of boys with higher psychopathy scores. More specifically, electrodermal hyporeactivity was linked to the interpersonal facet of psychopathy, suggesting that it is a biological marker of a manipulative and deceitful orientation in males. No association was found between SCRs and psychopathic traits in girls, indicating the importance of sex specific etiologies of psychopathy in childhood. (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

The conflict between precision and flexibility in explaining "beyond a reasonable doubt".

Though beyond a reasonable doubt is a common phrase inside and outside the courtroom, courts have struggled to define the phrase or to set clear standards for an adequate definition. The struggle has important implications because empirical evidence reveals that the choice of definition can influence the jury's verdict. The authors analyze the variety of proposed definitions, including the quantified definitions that some have advocated, setting out 5 criteria for an adequate definition consistent with both legal requirements and empirical evidence. They also suggest that the push for precision, such as that promised by a quantified definition in the form of a single percentage, may produce a loss of desirable flexibility. A structured flexibility permitting the trier of fact to adjust the stringency of the standard to reflect the severity of the offense and the costs associated with error may be a virtue worth fostering. (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

Association of a host DNA structure with retroviral integration sites in chromosomal DNA

Integration of retroviral genomes is a site-specific process with respect to the virus but not the host genome. Numerous chromosomal sites and various sequences can be used as targets. Nevertheless, preferential regions and integration patterns have been observed. Using a functional assay, we investigated if host structural DNA elements could be associated with retroviral integration sites. The results were that 9 of 10 distinct retroviral integration events occurred in close proximity of structural elements behaving like intrinsically bent DNA.     

Pax-3-DNA interaction: flexibility in the DNA binding and induction of DNA conformational changes by paired domains

The mouse Pax-3 gene encodes a protein that is a member of the Pax family of DNA binding proteins. Pax-3 contains two DNA binding domains: a paired domain (PD) and a paired type homeodomain (HD). Both domains are separated by 53 amino acids and interact synergistically with a sequence harboring an ATTA motif (binding to the HD) and a GTTCC site (binding to the PD) separated by 5 base pairs. Here we show that the interaction of Pax-3 with these two binding sites is independent of their angular orientation. In addition, the protein spacer region between the HD and the PD can be shortened without changing the spatial flexibility of the two DNA binding domains which interact with DNA. Furthermore, by using circular permutation analysis we determined that binding of Pax-3 to a DNA fragment containing a specific binding site causes conformational changes in the DNA, as indicated by the different mobilities of the Pax-3-DNA complexes. The ability to change the conformation of the DNA was found to be an intrinsic property of the Pax-3 PD and of all Pax proteins that we tested so far. These in vitro studies suggest that interaction of Pax proteins with their specific sequences in vivo may result in an altered DNA conformation.     

An association between air pollution and mortality in six U.S. cities

BACKGROUND: Recent studies have reported associations between particulate air pollution and daily mortality rates. Population-based, cross-sectional studies of metropolitan areas in the United States have also found associations between particulate air pollution and annual mortality rates, but these studies have been criticized, in part because they did not directly control for cigarette smoking and other health risks. METHODS: In this prospective cohort study, we estimated the effects of air pollution on mortality, while controlling for individual risk factors. Survival analysis, including Cox proportional-hazards regression modeling, was conducted with data from a 14-to-16-year mortality follow-up of 8111 adults in six U.S. cities. RESULTS: Mortality rates were most strongly associated with cigarette smoking. After adjusting for smoking and other risk factors, we observed statistically significant and robust associations between air pollution and mortality. The adjusted mortality-rate ratio for the most polluted of the cities as compared with the least polluted was 1.26 (95 percent confidence interval, 1.08 to 1.47). Air pollution was positively associated with death from lung cancer and cardiopulmonary disease but not with death from other causes considered together. Mortality was most strongly associated with air pollution with fine particulates, including sulfates. CONCLUSIONS: Although the effects of other, unmeasured risk factors cannot be excluded with certainty, these results suggest that fine-particulate air pollution, or a more complex pollution mixture associated with fine particulate matter, contributes to excess mortality in certain U.S. cities.     

The association between parental warmth and control in thirteen cultural groups.

The goal of the current study was to investigate potential cross-cultural differences in the covariation between two of the major dimensions of parenting behavior: control and warmth. Participants included 1,421 (51% female) 7- to 10-year-old (M = 8.29, SD = .67 years) children and their mothers and fathers representing 13 cultural groups in nine countries in Africa, Asia, Europe, the Middle East, and North and South America. Children and parents completed questionnaires and interviews regarding mother and father control and warmth. Greater warmth was associated with more control, but this association varied widely between cultural groups. (PsycINFO Database Record (c) 2011 APA, all rights reserved)     

The relationship between anxiety and oral word association performance.

To test the comparative validity of 2 theories of anxiety (Sarason's interfering response and Spence and Taylor's drive theory), associations to word stimuli were analyzed. According to drive theory, anxiety should interfere with the number of different associations to the same word. Words that stimulate few associations should result in short reaction times and few disturbance of responsiveness and rare responses. According to interference theory there should be an effect upon association without an interaction between the degree of association value of the word and anxiety level of S. The results were interpreted as supporting Sarason's theory. From Psyc Abstracts 36:04:4HK68G. (PsycINFO Database Record (c) 2010 APA, all rights reserved)