Human MSH2 binds to trinucleotide repeat DNA structures associated with neurodegenerative diseases

The expansion of trinucleotide repeat sequences is associated with several neurodegenerative diseases. The mechanism of this expansion is unknown but may involve slipped-strand structures where adjacent rather than perfect complementary sequences of a trinucleotide repeat become paired. Here, we have studied the interaction of the human mismatch repair protein MSH2 with slipped-strand structures formed from a triplet repeat sequence in order to address the possible role of MSH2 in trinucleotide expansion. Genomic clones of the myotonic dystrophy locus containing disease-relevant lengths of (CTG)n x (CAG)n triplet repeats were examined. We have constructed two types of slipped-strand structures by annealing complementary strands of DNA containing: (i) equal numbers of trinucleotide repeats (homoduplex slipped structures or S-DNA) or (ii) different numbers of repeats (heteroduplex slipped intermediates or SI-DNA). SI-DNAs having an excess of either CTG or CAG repeats were structurally distinct and could be separated electrophoretically and studied individually. Using a band-shift assay, the MSH2 was shown to bind to both S-DNA and SI-DNA in a structure-specific manner. The affinity of MSH2 increased with the length of the repeat sequence. Furthermore, MSH2 bound preferentially to looped-out CAG repeat sequences, implicating a strand asymmetry in MSH2 recognition. Our results are consistent with the idea that MSH2 may participate in trinucleotide repeat expansion via its role in repair and/or recombination.     

PSTPIP 2, a second tyrosine phosphorylated, cytoskeletal-associated protein that binds a PEST-type protein-tyrosine phosphatase

Although cytoskeletal regulation is critical to cell function during interphase and mitosis, the components of the cytoskeleton involved with its control are only beginning to be elucidated. Recently, we reported the identification of a cytoskeletal-associated protein, proline-serine-threonine phosphatase-interacting protein (PSTPIP), whose level of tyrosine phosphorylation was controlled by PEST-type protein-tyrosine phosphatases (PTPs) bound to a novel protein interaction site in the PSTPIP predicted coiled-coil domain. We also showed that the PSTPIP SH3 domain interacts with the Wiskott-Aldrich syndrome protein (WASP), a cytoskeletal regulatory protein, in a manner modulated by tyrosine phosphorylation. Here we describe the identification of PSTPIP 2, a widely expressed protein that is related to PSTPIP. PSTPIP 2 lacks an SH3 domain but contains a region predicted to bind to PEST-type PTPs, and structure-function analyses demonstrate that PSTPIP 2 interacts with the proline-rich C terminus of the PEST-type PTP hematopoietic stem cell factor in a manner similar to that previously demonstrated for PSTPIP. Confocal microscopy revealed that PSTPIP 2 colocalizes with PSTPIP in F actin-rich regions. PSTPIP 2 was found to be efficiently phosphorylated in v-Src-transfected or pervanadate-treated cells at two tyrosines conserved in PSTPIP, but in contrast to PSTPIP, tyrosine phosphorylated PSTPIP 2 was only weakly dephosphorylated in the presence of PTP HSCF. Finally, analysis of oligomer formation demonstrated that PSTPIP and PSTPIP 2 formed homo- but not heterodimers. These data suggest that a family of tyrosine phosphorylated, PEST PTP binding proteins may be implicated in cytoskeletal regulation.     

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.     

The yeast telomere length regulator TEL2 encodes a protein that binds to telomeric DNA

TEL2 is required for telomere length regulation and viability in Saccharomyces cerevisiae. To investigate the mechanism by which Tel2p regulates telomere length, the majority (65%) of the TEL2 ORF was fused to the 3'-end of the gene for maltose binding protein, expressed in bacteria and the purified protein used in DNA binding studies. Rap1p, the major yeast telomere binding protein, recognizes a 13 bp duplex site 5'-GGTGTGTGGGTGT-3' in yeast telomeric DNA with high affinity. Gel shift experiments revealed that the MBP-Tel2p fusion binds the double-stranded yeast telomeric Rap1p site in a sequence-specific manner. Analysis of mutated sites showed that MBP-Tel2p could bind 5'-GTGTGTGG-3' within this 13 bp site. Methylation interference analysis revealed that Tel2p contacts the 5'-terminal guanine in the major groove. MBP-Tel2p did not bind duplex telomeric DNA repeats from vertebrates, Tetrahymena or Oxytricha. These results suggest that Tel2p is a DNA binding protein that recognizes yeast telomeric DNA.     

DNA replication is completed in Saccharomyces cerevisiae cells that lack functional Cdc14, a dual-specificity protein phosphatase

A 35-year-old man affected with pulmonary sarcoidosis had a 12-year history of fatigue and pain in the limbs, with normal neurological examination, except for diffusely absent deep tendon reflexes. Muscle biopsy samples showed multiple noncaseating granulomas, most prominent around the intramuscular nerves, with predominance of CD4+ cells. Intramuscular nerve bundles surrounded by granulomas were immunolabelled with laminin alpha1, alpha2, beta1 and gamma1 chain, and collagen IV. Sural nerve biopsy samples were normal. This patient showed a unique histopathological pattern of sarcoid neuromyopathy characterized by distribution of granulomas or infiltrating cells around intramuscular nerve fibers. The clinical picture, restricted to nonspecific symptoms of fatigue and myalgia, and loss of deep tendon reflexes, correlated well with the selective localization of sarcoid lesions in contiguity with the intramuscular nerves. To our knowledge, this peculiar clinico-pathological correlation has not been reported previously.     

Biochemical characterization of mapmodulin, a protein that binds microtubule-associated proteins

Mapmodulin is a 31-kDa protein that stimulates the microtubule- and dynein-dependent localization of Golgi complexes in semi-intact Chinese hamster ovary cells. We have shown previously that it binds the microtubule binding domains of the microtubule-associated proteins, MAP2, MAP4, and tau. We also showed that mapmodulin is identical to a protein named PHAPI (Vaesen, M., Barnikol-Watanabe, S. , G?tz, H., Awni, L.A., Cole, T., Zimmermann, B., Kratzin, H.D. and Hilschmann, N. (1994) Biol. Chem. Hoppe-Seyler 375, 113-126). We report here that mapmodulin is a phosphoprotein that is predominantly cytosolic but is also found peripherally associated with endoplasmic reticulum and Golgi membranes in mammalian cells. The protein occurs as a trimer in cytosol, and phosphorylation is required for its microtubule-associated protein-binding activity. Heat treatment of nonphosphorylated mapmodulin can render it competent for binding to microtubule-associated proteins, suggesting that phosphorylation induces a conformational change in mapmodulin. Finally, despite identity in polypeptide sequence with a protein reported to act as an inhibitor of protein phosphatase 2A, native mapmodulin was not able to inhibit protein phosphatase 2A in Chinese hamster ovary cell cytosol.     

Requirement of mismatch repair genes MSH2 and MSH3 in the RAD1-RAD10 pathway of mitotic recombination in Saccharomyces cerevisiae

Female wild Japanese monkeys (Macaca fuscata), as with all male cercopithecoids, use the mesiobuccal surfaces or the elongated crests of the mandibular third premolars (P3s), as cutting blocks that wear against edges of maxillary canines during threat manifestation or food-eating. In other words, the crests of their P3s are honed with the maxillary canines. The crests become sloped during growth and more heavily striated with the advance of age. The number, directions, lengths, and widths of these striations have been analyzed quantitatively using scanning electron microscopy (SEM). Two samples showed two distinct types of parallel striations, one longer and thicker (171.5 microns long and 14.5 microns wide on average) than the other (114.8 microns long and 12.0 microns wide on average). These striations were caused by contact between the sharp edge of the upper canine and the P3 during honing (canine/premolar complex). The long and thick striations are asymmetrical with widened parts or pits on one end, and were easily distinguished from other thinner striations which may have been caused by fine particles. The third sample showed Hunter-Schreger bands with striae of Retzius on the sloping heavily worn mesiobuccal surface. The features of these thick parallel striations indicate that they result from closing movements of the jaw.     

Saccharomyces cerevisiae elongation factor 2. Mutagenesis of the histidine precursor of diphthamide yields a functional protein that is resistant to diphtheria toxin

Protein synthesis elongation factor 2 (EF-2) is the target of the ADP-ribosylating activity of diphtheria toxin which is responsible for cell killing. Diphthamide, an unique post-translationally modified histidine residue, is both required for and the site of this ADP-ribosylation. Although present in the EF-2 of all eukaryotes and archaebacteria, the function of diphthamide is unknown. Here we describe the site-specific mutagenesis of the histidine precursor of diphthamide, histidine 699, in yeast EF-2. Plasmid-borne EFT was randomly mutagenized at the histidine 699 codon, and the technique of plasmid shuffling was utilized to select strains that were maintained by the mutant EFT. These mutants were screened for diphtheria toxin resistance. Sequence analysis of the EFT in 49 toxin-resistant isolates showed that histidine 699 had been replaced by 1 of 4 amino acids: asparagine, glutamine, leucine, or methionine. All 11 of the possible codons corresponding to these 4 amino acids were found. The growth rates of cells sustained by the mutant forms of EF-2 were slightly slower than those of isogenic wild-type cells. We conclude that despite its strict conservation and universal post-translational modification, the histidine precursor of diphthamide is not essential to the function of yeast EF-2 in protein synthesis.     

Ras2 and Ras1 protein phosphorylation in Saccharomyces cerevisiae

This work describes the phosphorylation of Saccharomyces cerevisiae Ras proteins and explores the physiological role of the phosphorylation of Ras2 protein. Proteins expressed from activated alleles of RAS were less stable and less phosphorylated than proteins from cells expressing wild-type alleles of RAS. This difference in phosphorylation level did not result from increased signaling through the Ras-cAMP pathway or reflect the primarily GTP-bound nature of activated forms of Ras protein per se. In addition, phosphorylation of Ras protein was not dependent on proper localization of the Ras2 protein to the plasma membrane nor on the interaction of Ras2p with its exchange factor, Cdc25p. The preferred phosphorylation site on Ras2 protein was identified as serine 214. This site, when mutated to alanine, led to promiscuous phosphorylation of Ras2 protein on nearby serine residues. A decrease in phosphorylation may lead to a decrease in signaling through the Ras-cAMP pathway.     

ARH1 of Saccharomyces cerevisiae: a new essential gene that codes for a protein homologous to the human adrenodoxin reductase

A yeast gene was found in which the derived protein sequence has similarity to human and bovine adrenodoxin reductase (Nobrega, F. G., Nobrega, M. P. and Tzagoloff, A. (1992). EMBO J. 11, 3821-3829; Lacour, T. and Dumas, B. (1996). Gene 174, 289 292), an enzyme in the mitochondrial electron transfer chain that catalyses in mammals the conversion of cholesterol into pregnenolone, the first step in the synthesis of all steroid hormones. It was named ARH1 (Adrenodoxin Reductase Homologue 1) and here we show that it is essential. Rescue was possible by the yeast gene, but failed with the human gene. Supplementation was tried without success with various sterols, ruling out its involvement in the biosynthesis of ergosterol. Immunodetection with a specific polyclonal antibody located the gene product in the mitochondrial fraction. Consequently ARH1p joins the small group of gene products that affect essential functions carried out by the organelle and not linked to oxidative phosphorylation.     

A novel a-factor-related peptide of Saccharomyces cerevisiae that exits the cell by a Ste6p-independent mechanism

Many secreted signaling molecules are synthesized as precursors that undergo multiple maturation steps to generate their mature forms. The Saccharomyces cerevisiae mating pheromone a-factor is a C-terminally isoprenylated and carboxylmethylated dodecapeptide that is initially synthesized as a larger precursor containing 36 or 38 amino acids. We have previously shown that the maturation of a-factor occurs by an ordered biogenesis pathway involving 1) three C-terminal modification steps, 2) two N-terminal proteolytic processing events, and 3) a nonclassical export mechanism mediated by the ATP-binding-cassette (ABC) transporter Ste6p. In the present study, we demonstrate that an unexpected and abundant a-factor-related peptide (AFRP) exists in the culture fluid of MATa cells and that its biogenesis is integrally related to that of mature a-factor itself. We show by purification followed by mass spectrometry that AFRP corresponds to the C-terminal 7 amino acids (VFWDPAC) of mature a-factor (YIIKGVFWDPAC), including both the farnesyl- and carboxylmethylcysteine modifications. The formation and export of AFRP displays three striking features. First, we show that AFRP is produced intracellularly and that mutants (ste24 and axl1) that cannot produce mature a-factor due to an N-terminal processing defect are nevertheless normal for AFRP production. Thus, AFRP is not derived from mature a-factor but, instead, from the P1 form of the a-factor precursor. Second, fusion constructs with foreign amino acids substituted for authentic a-factor residues still yield AFRP-sized molecules; however, the composition of these corresponds to the altered residues instead of to AFRP residues. Thus, AFRP may be generated by a sequence-dependent but length-specific proteolytic activity. Third, a-factor and AFRP use distinct cellular machinery for their secretion. Whereas a-factor export is Ste6p-dependent, AFRP is secreted normally even in a ste6 deletion mutant. Thus, AFRP may exit the cell by another ATP-binding-cassette transporter, a different type of transporter altogether, or possibly by diffusion. Taken together, these studies indicate that the biogenesis of AFRP involves novel mechanisms and machinery, distinct from those used to generate mature a-factor. Because AFRP neither stimulates nor inhibits mating or a-factor halo activity, its function remains an intriguing question.     

Gads is a novel SH2 and SH3 domain-containing adaptor protein that binds to tyrosine-phosphorylated Shc

Shc proteins are important substrates of receptor and cytoplasmic tyrosine kinases that couple activated receptors to downstream signaling enzymes. Phosphorylation of Shc tyrosine residues 239 and 317 leads to recruitment of the Grb2-Sos complex, thus linking Shc phosphorylation to Ras activation. We have used phosphorylated peptides corresponding to the regions spanning tyrosine 239/240 and 317 of Shc in an expression library screen to identify additional downstream targets of Shc. Here we report the identification of Gads, a novel adaptor protein most similar to Grb2 and Grap that contains amino and carboxy terminal SH3 domains flanking a central SH2 domain and a 120 amino acid unique region. Gads is most highly expressed in the thymus and spleen of adult animals and in human leukemic cell lines. The binding specificity of the Gads SH2 domain is similar to Grb2 and mediates the interaction of Gads with Shc, Bcr-Abl and c-kit. Gads does not interact with Sos, Cbl or Sam68, although the isolated carboxy terminal Gads SH3 domain is able to bind these molecules in vitro. Our results suggest that the unique structure of Gads regulates its interaction with downstream SH3 domain-binding proteins and that Gads may function to couple tyrosine-phosphorylated proteins such as Shc, Bcr-Abl and activated receptor tyrosine kinases to downstream effectors distinct from Sos and Ras.     

Biochemical evidence that Saccharomyces cerevisiae YGR262c gene, required for normal growth, encodes a novel Ser/Thr-specific protein kinase

BACKGROUND AND PURPOSE: This study was designed to determine regional differences and age-related changes in the contribution of ATP-sensitive potassium (KATP) channels to vasodilator responses in the brain stem circulation in vivo. METHODS: Changes in diameter of the basilar artery (baseline diameter, 270 +/- 5 microns [mean +/- SEM]), its large branch (112 +/- 5 microns), and its small branch (49 +/- 2 microns) in response to KATP channel openers levcromakalim and Y-26763 were measured through a cranial window in anesthetized adult (4 to 6 months) and aged (24 to 26 months) Sprague-Dawley rats. RESULTS: Topical application of levcromakalim and Y-26763 produced concentration-dependent vasodilation that was similar among the three vessel groups in adult rats. In aged rats, dilator responses of the branches, but not of the basilar artery, to the KATP channel openers were smaller than those in adult rats (P < .05). Glibenclamide, a selective KATP channel blocker, almost abolished this vasodilation in both groups of rats. Vasodilator responses to sodium nitroprusside were preserved in aged rats. CONCLUSIONS: In adult rats, there is no regional heterogeneity in vasodilator response to KATP channel openers in the brain stem circulation in vivo. In aged rats, although KATP channels are also functional in the brain stem circulation, dilator response of the microvessels but not of the large arteries to direct activation of KATP channels is impaired.     

DNA-binding activities of Hop1 protein, a synaptonemal complex component from Saccharomyces cerevisiae

The meiosis-specific HOP1 gene is important both for crossing over between homologs and for production of viable spores. hop1 diploids fail to assemble synaptonemal complex (SC), which normally provides the framework for meiotic synapsis. Immunochemical methods have shown that the 70-kDa HOP1 product is a component of the SC. To assess its molecular function, we have purified Hop1 protein to homogeneity and shown that it forms dimers and higher oligomers in solution. Consistent with the zinc-finger motif in its sequence, the purified protein contained about 1 mol equivalent of zinc whereas mutant protein lacking a conserved cysteine within this motif did not. Electrophoretic gel mobility shift assays with different forms of M13 DNA showed that Hop1 binds more readily to linear duplex DNA and negatively superhelical DNA than to nicked circular duplex DNA and even more weakly to single-stranded DNA. Linear duplex DNA binding was enhanced by the addition of Zn2+, was stronger for longer DNA fragments, and was saturable to about 55 bp/protein monomer. Competitive inhibition of this binding by added oligonucleotides suggests preferential affinity for G-rich sequences and weaker binding to poly(dA-dT). Nuclear extracts of meiotic cells caused exonucleolytic degradation of linear duplex DNA if the extracts were prepared from hop1 mutants; addition of purified Hop1 conferred protection against this degradation. These findings suggest that Hop1 acts in meiotic synapsis by binding to sites of double-strand break formation and helping to mediate their processing in the pathway to meiotic recombination.     

Histone H1; a neuronal protein that binds bacterial lipopolysaccharide

Bacterial lipopolysaccharide (LPS) is a potent inflammogen following systemic infection. Macrophages express a number of surface molecules including CD14, CD18 and the scavenger receptor that are capable of recognizing and binding LPS. Injection of the CNS with LPS produces an atypical inflammatory response including a delay in the recruitment of macrophages to the brain parenchyma. We have shown using a ligand blot overlay approach, that LPS is capable of binding to histone H1 present in brain homogenate. The ability of LPS to bind to H1 has only been previously shown for monocytes. Subsequent immunohistochemistry revealed that the anti-H1 antibody, ANA-108, stained neuronal cell bodies and was located in the membrane, possibly at the cell surface. Further experiments revealed that the H1 antigen recognized by the ANA-108 antibody was not a histone wholly restricted to the nucleus but may represent a novel CNS form of the protein. This observation has implications for the autoimmune disease systemic lupus erythematosus (SLE) due to the presence of auto-antibodies, particularly against DNA and nuclear proteins, in serum. The formation of immune complexes in various organs leads to severe dysfunction. Anti-histone antibodies are typical of the auto-antibodies found in SLE serum and the presence of the H1 antigen on the surface of neurons could provide an insight into biology underlying the neurological problems associated with SLE.     

Detection, purification and characterization of a protein that binds the (6-4) photoproduct-containing DNA in HeLa cells

HeLa cell proteins that bind DNA containing the pyrimidine(6-4)pyrimidone photoproduct were detected by the electrophoretic mobility shift assay using synthetic oligonucleotide duplexes as probes. The major species was purified to near homogeneity, and the amino acid sequences of the proteolytic peptides revealed that it was the human damage-specific DNA-binding protein, which was reported previously. The substrate specificity of this protein was determined using damaged or modified DNA duplexes.