Extreme discordant sib pairs for mapping quantitative trait loci in humans

Analysis of differences between siblings (sib pair analysis) is a standard method of genetic linkage analysis for mapping quantitative trait loci, such as those contributing to hypertension and obesity, in humans. In traditional designs, pairs are selected at random or with one sib having an extreme trait value. The majority of such pairs provide little power to detect linkage; only pairs that are concordant for high values, low values, or extremely discordant pairs (for example, one in the top 10 percent and the other in the bottom 10 percent of the distribution) provide substantial power. Focus on discordant pairs can reduce the amount of genotyping necessary over conventional designs by 10- to 40-fold.     

Linkage of circulating eosinophils to markers on chromosome 5q

Although peripheral blood eosinophilia is strongly associated with the risk of developing asthma, genetic determinants of eosinophilia have not been extensively studied. We used sib-pair analysis to assess linkage of circulating eosinophils (as a percent of total white blood cells [WBC]) to nine markers located in chromosome 5q31-33. The study was divided into two phases. Of 246 sib pairs available for the first phase, 35 were classified as low concordant (LC) (both sibs had <= 2% circulating eosinophils), 18 were defined as high concordant (HC) (both sibs had 5% or more circulating eosinophils), and 26 were defined as discordant (one sib had <= 2% and the other sib had 5% or more circulating eosinophils). Significant evidence for linkage among low concordant sib pairs was found for several markers in the region under study, with a peak for marker D5S500 (proportion of alleles shared identical by descent [ibd] = 0.68 +/- 0.05 [mean +/- SE], p = 0.0004). A cross-validating study was done in which an additional 19 sib pairs that were low concordant for circulating eosinophils were studied. Evidence for linkage was also observed in this subset. Results were independent of current wheezing, total serum IgE levels, and other potential confounders. A multipoint analysis done for all low-concordant sib pairs available showed that the maximal logarithm of the odds favoring genetic linkage (LOD) score (2.4, p = 0.0004) was observed in correspondence with marker D5S658. We conclude that a locus or loci may be present in chromosome 5q31-33 that controls for circulating eosinophils as a proportion of total WBC.     

Linkage of genetic markers on human chromosomes 20 and 12 to NIDDM in Caucasian sib pairs with a history of diabetic nephropathy

The potential contribution of maturity-onset diabetes of the young (MODY) genes to NIDDM susceptibility in African-American and Caucasian NIDDM-affected sibling pairs with a history of adult-onset diabetic nephropathy has been evaluated. Evidence for linkage to NIDDM was found with polymorphic loci that map to the long arms of human chromosomes 20 and 12 in regions containing the MODY1 and MODY3 genes. Nonparametric analysis of chromosome 20 inheritance data collected with the MODY1-linked marker D20S197 provides evidence for linkage to NIDDM with a P value of 0.005 in Caucasian sib pairs using affected sibpair (ASP) analyses. Non-parametric analysis of chromosome 12 inheritance data collected with the MODY3-linked markers D12S349 and D12S86 provides evidence for linkage to NIDDM with P values of 0.04 and 0.006, respectively, in Caucasian sib pairs using similar analyses. No evidence for linkage of MODY1 and MODY3 markers to NIDDM in African-American sib pairs was observed. In addition, no evidence for linkage to MODY2 (glucokinase-associated MODY) was observed with either study population. Results of multipoint maximum logarithm of odds (LOD) score analysis were consistent with the ASP results. A maximum LOD score of 1.48 was calculated for linkage to MODY1-linked loci and 1.45 to MODY3-linked loci in Caucasian sib pairs. Tabulation of allele sharing in affected sib pairs with D20S197 and D12S349 suggests that affected sibling pairs may inherit susceptibility genes simultaneously from chromosome 20 and chromosome 12. The results suggest that genes contributing to NIDDM in the general Caucasian population are located in the regions containing the MODY1 and MODY3 genes.     

Reliability of potential clinical measures of muscle tone in the elbows of patients after stroke

In order to establish a genotype-phenotype relationship, we have identified both mutant phenylalanine hydroxylase (PAH) genes in 108 phenylketonuria (PKU) patients (27 different alleles, 54 different genotypes). One major group of patients with very high pretreatment phenylalanine values ("classical" PKU) exclusively comprised homozygotes of the PKU mutations I65T, G272X, F299C, Y356X, R408W, IVS12nt1, and compound heterozygotes of various combinations of these alleles with G46S, R261Q, R252W, A259T, R158Q, D143G, R243X, E280K, or Y204C. A second major group of patients with lower phenylalanine values ("mild" PKU) comprised mutations A300S, R408Q, Y414C in various compound heterozygous states, and R261Q, R408Q, Y414C in homozygotes. The phenylalanine values in these groups were non-overlapping. In addition, a smaller group of patients formed the transition between the two main groups. In sib pairs 4 of 15 had discordant pretreatment phenylalanine values. Conclusion: Our results are consistent with the view that allelic heterogeneity at the PAH locus dominates the biochemical phenotype in PKU and that genotype information is able to predict the metabolic phenotype in PKU patients.     

Association of posterior p-values of S.A.G.E. SIBPAL proportion-IBD and Haseman-Elston statistics for ACTHR112

A common practice among researchers performing linkage studies is the use of equal allele frequencies as input when reporting p-values from computer linkage programs such as S.A.G.E. SIBPAL. Our results, using 5,000 sets from a uniform-prior distribution of allele frequencies, showed that such input may be problematic. Further, we found that the S.A.G.E. SIBPAL test for proportion of alleles shared identical by descent among concordantly affected sib pairs showed a greater percentage of significant p-values with decreasing parental genotype information (Table III), while the S.A.G.E. SIBPAL Haseman-Elston test produced significant p-values comparatively less frequently (Table IV).     

Preliminary evidence of linkage of salt sensitivity in black Americans at the beta 2-adrenergic receptor locus

Salt sensitivity is a heritable trait that is a hallmark of hypertension in black Americans. Genes encoding adrenergic receptors are candidate loci for the inheritance of this hypertension-related trait because of the role of these receptors in the regulation of renal sodium excretion and vascular tone. We performed this study to determine whether these loci are responsible for some of the phenotypic variation in salt sensitivity. Hypertensive black American probands were ascertained, followed by sequential ascertainment of adult sib pairs among the first-, second- and third-degree relatives of the proband. Both hypertensive and normotensive siblings were tested for salt sensitivity by an intravenous sodium-loading, lasix volume-depletion protocol. Genotyping was performed with restriction fragment length polymorphisms in genomic DNA probed with clones containing the beta 2- and alpha 2c10-adrenergic receptor genes. A total of 109 sib pairs was evaluated. Salt sensitivity was defined as the change in blood pressure in each individual, comparing the sodium-loaded with the volume-depleted state. Systolic pressure decreased by an average of 9.0 +/- 9%, diastolic pressure by 1.5 +/- 11%, and mean arterial pressure by 5.0 +/- 9%. Neither blood pressure nor salt sensitivity was linked at the alpha 2c10-adrenergic receptor locus. No evidence suggested that systolic salt sensitivity and baseline blood pressure were linked at the beta 2-adrenergic receptor locus. Model-independent sib pair linkage analysis suggested that diastolic blood pressure response to sodium loading/volume depletion is linked at the beta 2-adrenergic receptor locus (P < .006). Evidence for linkage was significant at the .05 level after adjustment for the number of phenotypic traits examined.     

Effects of genotype-by-sex interaction on quantitative trait linkage analysis

Genotype-by-sex (G x S) interaction refers to the interaction of autosomal genes with male or female physiological "environments." G x S interaction has been demonstrated in quantitative genetic analysis of a variety of traits including serum lipid concentrations and anthropometrics, and the importance of considering sex-specific major gene effects in segregation analyses also has been demonstrated. The goal of this study was to examine the effects of G x S interaction on the power to detect linkage. Trait Q3 in GAW10 Problem 2 was analyzed because it was modeled to have G x S interaction at the major gene locus MG3. All 200 nuclear family and 200 extended pedigree replicates were first screened for the presence of G x S interaction in Q3 using a quantitative genetic method. More than half of both the nuclear family and extended pedigree replicates evidenced significant G x S interaction. Variance components linkage analysis was then performed using all markers on GAW10 chromosome 4 in all 200 nuclear family and 200 extended pedigree replicates. A peak lod score of 1.92 at the correct chromosomal location was obtained using the extended pedigree data and incorporating G x S interaction effects. Not incorporating G x S interaction lowered the peak lod score from the analyses of the extended pedigrees to 1.53. Incorporation of G x S interaction effects also increased the power to detect linkage in the nuclear family replicates, although the nuclear families had considerably less power than the extended pedigrees to detect linkage, whether or not G x S interaction was modeled. Incorporation of G x S interaction effects can increase the power to detect linkage, even when the G x S interaction effects are modest.     

Structural characterization of an N-acetyl-2-aminofluorene (AAF) modified DNA oligomer by NMR, energy minimization, and molecular dynamics

An N-acetyl-2-aminofluorene (AAF) modified deoxyoligonucleotide duplex, d(C1-C2-A3-C4-[AAF-G5]-C6-A7-C8-C9).d(G10-G11-T12-G13-C14-++ +G15-T16-G17-G18), was studied by one- and two-dimensional NMR spectroscopy. Eight of the nine complementary nucleotides form Watson-Crick base pairs, as shown by NOEs between the guanine imino proton and cytosine amino protons for G.C base pairs or by an NOE between the thymine imino proton and adenine H2 proton for A.T base pairs. The AAF-G5 and C14 bases show no evidence of complementary hydrogen bond formation to each other. The AAF-G5 base adopts a syn conformation, as indicated by NOEs between the G5 imino proton and the A3-H3' and A3-H2'/H2" protons and by NOEs between the fluorene-H1 proton of AAF and the G5-H1' or C6-H1' proton. The NOEs from the C4-H6 proton to C4 sugar protons are weak, and thus the glycosidic torsion angle in this nucleotide is not well defined by these NMR data. The remaining bases are in the anti conformation, as depicted by the relative magnitude of the H8/H6 to H2' NOEs when compared to the H8/H6 to H1' NOEs. The three base pairs on each end of the duplex exhibit NOEs characteristic of right-handed B-form DNA. Distance restraints obtained from NOESY data recorded at 32 degrees C using a 100-ms mixing time were used in conformational searches by molecular mechanics energy minimization studies. The final, unrestrained, minimum-energy conformation was then used as input for an unrestrained molecular dynamics simulation. Chemical exchange cross peaks are observed, and thus the AAF-9-mer exists in more than a single conformation on the NMR time scale. The NMR data, however, indicate the presence of a predominant conformation (> or = 70%). The structure of the predominant conformation of the AAF-9-mer shows stacking of the fluorene moiety on an adjacent base pair, exhibiting features of the base-displacement [Grunberger, D., Nelson, J. H., et al. (1970) Proc. Natl. Acad. Sci. U.S.A. 66, 488-494] and insertion-denaturation models [Fuchs, R.P.P., & Daune, M. (1971) FEBS Lett. 14, 206-208], while the distal ring of the fluorene moiety protrudes into the minor groove.     

Sib-pair analysis detects elevated Lp(a) levels and large variation of Lp(a) concentration in subjects with familial defective ApoB

Whether or not Lp(a) plasma levels are affected by the apoB R3500Q mutation, which causes Familial Defective apoB (FDB), is still a matter of debate. We have analyzed 300 family members of 13 unrelated Dutch index patients for the apoB mutation and the apolipoprotein(a) [apo(a)] genotype. Total cholesterol, LDL-cholesterol, and lipoprotein(a) [Lp(a)] concentrations were determined in 85 FDB heterozygotes and 106 non-FDB relatives. Mean LDL levels were significantly elevated in FDB subjects compared to non-FDB relatives (P < 0.001). Median Lp(a) levels were not different between FDB subjects and their non-FDB relatives. In contrast, sib-pair analysis demonstrated a significant effect of the FDB status on Lp(a) levels. In sib pairs identical by descent for apo(a) alleles but discordant for the FDB mutation (n = 11) each sib with FDB had a higher Lp(a) level than the corresponding non-FDB sib. Further, all possible sib pairs (n = 105) were grouped into three categories according to the absence/presence of the apoB R3500Q mutation in one or both subjects of a sib pair. The variability of differences in Lp(a) levels within the sib pairs increased with the number (0, 1, and 2) of FDB subjects present in the sib pair. This suggests that the FDB status increases Lp(a) level and variability, and that apoB may be a variability gene for Lp(a) levels in plasma.     

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.     

Sib-pair collection strategies for complex diseases

When planning an affected sib pair collection for use in a genomewide search for complex trait loci, researchers must ask: (a) Which family structures will yield the most informative pairs? and (b) Should recruitment extend beyond the index sib pair? The optimal collection strategy will depend on the trait's genetic architecture, but this is rarely known for non-Mendelian diseases. In the present report, we study the consequences of collecting only those sib pairs arising from pedigrees with a precisely specified structure as opposed to a strategy that collects all affected sib pairs at random (i.e., blind to the affection status of first-degree relatives). The former approach turns out to be risky because the power of specific pedigree structures can vary dramatically even among models producing identical observable parameters (such as population prevalence and sibling recurrence rate). In contrast, the latter approach typically involves only a modest loss of power as compared with the optimal (but unknowable) design. Further, we compare the strategy of collecting all affected sib pairs at random with the alternative of imposing some modest limitations on family structure (e.g., presence of at least one unaffected sib or parent). The latter approach generally provides some increase in power but entails additional effort to contact and phenotype relatives: the overall merit of imposing such requirements needs to be evaluated in the context of the specific disease to be studied and of the clinical and analytical resources available. In addition, these findings suggest that a further explanation for failure to replicate positive complex trait linkages lies in differences in ascertainment strategy between data sets.     

Refined solution structure of 8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 opposite CpA in the complementary strand of an oligodeoxynucleotide duplex as determined by 1H NMR

The solution structure of d(CCATCAFBGATCC).d(GGATCAGATGG), containing the 8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 adduct, was refined using molecular dynamics restrained by NOE data obtained from 1H NMR. The modified guanosine was positioned opposite cytosine, while the aflatoxin moiety was positioned opposite adenosine in the complementary strand. Sequential 1H NOEs were interrupted between C5 and AFBG6, but intrastrand NOEs were traced through the aflatoxin moiety, via H6a of aflatoxin and H8 of the modified guanine. Opposite the lesion, the NOE between A16 H1' and G17 H8 was weak. A total of 43 NOEs were observed between DNA protons and aflatoxin protons. Molecular dynamics calculations restrained with 259 experimental and empirical distances, and using sp2 hybridization at AFBG6 N7, refined structures with pairwise rms differences < 0.85 A, excluding terminal base pairs. Relaxation matrix calculations yielded a sixth root rms difference between refined structures and NOE intensity data of 7.3 x 10(-2). The aflatoxin moiety intercalated on the 5'-face of the modified guanine. The extra adenine A16 was inserted between base pair AFBG6.C15 and the aflatoxin moiety. A 36 degree bending between the plane of base pair AFBG6.C15 and the plane of the aflatoxin moiety was predicted. The aflatoxin moiety stacked below the top domain of the oligodeoxynucleotide, which consisted of base pairs C1.G21, C2.G20, A3.T19, T4.A18, and C5.G17. The bottom domain consisted of base pairs AFBG6.C15, A7.T14, T8.A13, C9.G12, and C10.G11. The average winding angle between base pair C5.G17, the intercalated aflatoxin moiety, A16, and base pair AFBG6.C15 was reduced to 10 degrees. The preponderance of base pair substitutions in the aflatoxin B1 mutational spectrum, particularly G-->T transversions, suggests that the stability of this modified oligodeoxynucleotide, which models a templated +1 addition mutation, does not reliably predict the frequency of frame shifts.     

Evaluating medication response in ADHD: cognitive, behavioral, and single-subject methodology

We introduce a novel application for linkage analysis: using bone marrow donor-recipient sib pairs to search for genes influential in graft-versus-host disease (GVHD), a major cause of morbidity and mortality following allogeneic bone marrow transplantation. In particular, we show that transplant sib pairs in which the recipient developed severe GVHD can be used to map genes in the same way as traditional discordant (affected/unaffected) sib pairs (DSPs). For a plausible GVHD model, we demonstrate that the transplant/discordant sib pair analog of the "possible triangle test" [Holmans (1993) Am J Hum Genet 52:362-374] has similar power to that of the simpler "restricted test" proposed by Risch [(1990b) Am J Hum Genet 46:229-241; (1992) Am J Hum Genet 51:673-675]. Moreover, we show that the restricted test has superior power in much of the DSP possible triangle and significantly inferior power in only a small region. Thus, we conclude that the restricted test is preferable for localizing genes with transplant/discordant sib pairs. Finally, we examine the effects of heterogeneity on the power to detect GVHD loci and demonstrate the gain in efficiency by dividing the sample into genetically more homogeneous subgroups.     

The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure

A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.     

Simple, robust linkage tests for affected sibs

Parametric-linkage analysis applied to large pedigrees with many affected individuals has helped in the identification of highly penetrant genes; but, for diseases lacking a clear Mendelian inheritance pattern or caused by several genes of low to moderate penetrance, a more robust strategy is nonparametric analysis applied to small sets of affected relatives, such as affected sib pairs. Here we show that the robustness of affected-sib-pair tests is related to the shape of the constraint set for the sibs' identity-by-descent (IBD) probabilities. We also derive a set of constraints for the IBD probabilities of affected sib triples and use common features of the shapes of the two constrain sets to introduce new nonparametric tests (called "minmax" tests) that are more robust than those in current use. Asymptotic-power computations support the robustness of the proposed minmax tests.     

Glutamine substitution at alanine1649 in the S4-S5 cytoplasmic loop of domain 4 removes the voltage sensitivity of fast inactivation in the human heart sodium channel

Normal activation-inactivation coupling in sodium channels insures that inactivation is slow at small but rapid at large depolarizations. M1651Q/M1652Q substitutions in the cytoplasmic loop connecting the fourth and fifth transmembrane segments of Domain 4 (S4-S5/D4) of the human heart sodium channel subtype 1 (hH1) affect the kinetics and voltage dependence of inactivation (Tang, L., R.G. Kallen, and R. Horn. 1996. J. Gen. Physiol. 108:89-104.). We now show that glutamine substitutions NH2-terminal to the methionines (L1646, L1647, F1648, A1649, L1650) also influence the kinetics and voltage dependence of inactivation compared with the wild-type channel. In contrast, mutations at the COOH-terminal end of the S4-S5/D4 segment (L1654, P1655, A1656) are without significant effect. Strikingly, the A1649Q mutation renders the current decay time constants virtually voltage independent and decreases the voltage dependences of steady state inactivation and the time constants for the recovery from inactivation. Single-channel measurements show that at negative voltages latency times to first opening are shorter and less voltage dependent in A1649Q than in wild-type channels; peak open probabilities are significantly smaller and the mean open times are shorter. This indicates that the rate constants for inactivation and, probably, activation are increased at negative voltages by the A1649Q mutation reminiscent of Y1494Q/ Y1495Q mutations in the cytoplasmic loop between the third and fourth domains (O'Leary, M.E., L.Q. Chen, R.G. Kallen, and R. Horn. 1995. J. Gen. Physiol. 106:641-658.). Other substitutions, A1649S and A1649V, decrease but fail to eliminate the voltage dependence of time constants for inactivation, suggesting that the decreased hydrophobicity of glutamine at either residues A1649 or Y1494Y1495 may disrupt a linkage between S4-S5/D4 and the interdomain 3-4 loop interfering with normal activation-inactivation coupling.     

NGF induces transient but not sustained activation of ERK in PC12 mutant cells incapable of differentiating

Calcium urolithiasis is often associated with increased intestinal absorption and urine excretion of calcium, and has been suggested to result from increased vitamin D production. The role of the enzyme 1 alpha-hydroxylase, the rate-limiting step in active vitamin D production, was evaluated in 36 families, including 28 sibships with at least a pair of affected sibs, using qualitative and quantitative trait linkage analyses. Sibs with a verified calcium urolithiasis passage (n = 117) had higher 24-h calciuria (P = 0.03), oxaluria (P = 0.02), fasting and postcalcium loading urine calcium/creatinine (Ca/cr) ratios (P = 0.008 and P = 0.002, respectively), and serum 1,25(OH)2 vitamin D levels (P = 0.02) compared with nonstone-forming sibs (n = 120). Markers from a 9-centiMorgan interval encompassing the VDD1 locus on chromosome 12q13-14 (putative 1 alpha-hydroxylase) were analyzed in 28 sibships (146 sib pairs) of single and recurrent stone formers and in 14 sibships (65 sib pairs) with recurrent-only (> or = 3 episodes) stone-forming sibs. Two-point and multipoint analyses did not reveal excess in alleles shared among affected sibs at the VDD1 locus. Linkage of stone formation to the VDD1 locus could be excluded, respectively, with a lambda d of 2.0 (single and recurrent stone formers) and 3.25 (recurrent stone formers). Quantitative trait analyses revealed no evidence for linkage to 24-h calciuria and oxaluria, serum 1,25(OH)2 vitamin D levels, and Ca/cr ratios. This study shows absence of linkage of the putative 1 alpha-hydroxylase locus to calcium stone formation or to quantitative traits associated with idiopathic hypercalciuria. In addition, there is coaggregation of calciuric and oxaluric phenotypes with stone formation.     

Association of the FcepsilonRIbeta gene with bronchial hyper-responsiveness in an Italian population

A study of two DNA polymorphisms (i2 RsaI, E237G) in the gene for the beta subunit of the IgE high affinity receptor (FcepsilonRIbeta) was performed in 168 Italian families with atopic asthmatic children. The prevalence of the E237G allele in the Italian population was 4%, so this polymorphism was unsuitable for this study. The i2 RsaI polymorphism minor allele frequency was 44%, and it had a PIC value of 0.37. Linkage analysis indicated a significant allele sharing in affected sib pairs for bronchial hyper-responsiveness (BHR, p=0.048), but not for allergic asthma. These data indicate an association of bronchial hyper-responsiveness with the FcepsilonRIbeta gene.