共查询到20条相似文献,搜索用时 0 毫秒
1.
PA Thompson R McAtee AJ Infante P Currier W Beninati KA Krolick 《Canadian Metallurgical Quarterly》1994,6(12):1807-1815
Immunization of C57BL/6 mice with purified acetylcholine receptor (AChR) is known to induce a T cell-dependent antibody response that results in experimental autoimmune myasthenia gravis (EAMG). Since past observations link V beta 6+ T cells with a prominent AChR epitope specificity, a V beta 6-specific immunotoxin (VIT6) was tested in vitro for its ability to selectively kill monoclonal and polyclonal T cells that demonstrate reactivity against AChR. Results described below clearly demonstrate the ability to selectively kill AChR-reactive T cells based on their expression of a particular V beta-associated antigen receptor. 相似文献
2.
B Damle D Hollenbaugh J Timoszyk L Tay S Kaul 《Canadian Metallurgical Quarterly》1998,19(2-3):145-165
BMS-191352 is a single-chain fusion protein composed of the variable regions of chimeric BR96 monoclonal antibody and the binding defective form of Pseudomonas Exotoxin A (PE40). The immunotoxin exhibits potent cytotoxicity against tumor cells expressing the Lewis antigen. A sensitive and specific double antibody sandwich ELISA has been developed and validated for the determination of BMS-191352 in rat and dog EDTA plasma. A monoclonal anti-PE40 antibody (EXA2-1H8) was used to capture BMS-191352 in plasma samples. The captured BMS-191352 was then detected using a biotinylated monoclonal BR96 antiidiotypic antibody (757-4-1) followed by the addition of streptavidin-horseradish peroxidase conjugate and chromogen 3,3',5,5'-tetramethylbenzidine. The optical density was measured at 450 nm. The standard curve range in rat and dog plasma was 2-32 ng/mL. The RSD for the inter- and intra-assay precision was within 9.2% and the accuracy was greater than 89.0%. The ELISA method was applied to the analysis of BMS-191352 in plasma samples from toxicokinetic studies conducted in rats and dogs. These studies revealed that the systemic exposure of BMS-191352 was dose proportional and the kinetics of BMS-191352 were linear between the dose range of 1.8-7.2 mg/m2 in the dog. 相似文献
3.
4.
Y Ogawa A Nishioka T Inomata S Yoshida KI Nakayama S Kataoka 《Canadian Metallurgical Quarterly》1998,2(4):403-408
PURPOSE: To investigate the incidence and clinical significance of primary or proposed secondary mitochondrial DNA (mtDNA) mutations in Japanese patients with Leber's hereditary optic neuropathy (LHON). METHODS: Blood samples from the 80 unrelated Japanese patients with bilateral optic atrophy were screened for primary LHON mutations. Patients found to have a primary LHON mutation were then tested for 9 proposed secondary LHON mutations. We investigated the association between these mutations and clinical characteristics. RESULTS: Primary mtDNA mutations were identified in 68 patients: at np 3460 in 3 (4%) of 68 patients, at np 11,778 in 59 patients (87%), and at np 14,484 in 6 patients (9%). We identified 5 secondary mtDNA mutations (at np 3394, 4216, 7444, 9438 or 13,708) in 10 (15%) of 68 LHON patients and 3 mutations (at np 3394, 4216 or 3708) in 6 (7%) of 90 healthy Japanese individuals. No patient was positive for more than one secondary mutation. The frequency of secondary mutations was similar in the 68 LHON patients and 90 controls. The clinical features of the Japanese patients with any of the 3 primary LHON mutations were similar to those of Caucasian patients, despite different mtDNA backgrounds in these populations. The percentage of patients with familial LHON harboring the 3460 or 14,484 mutations was lower in the Japanese population. CONCLUSIONS: Japanese patients with LHON exhibited a very high incidence (87%) of the 11,778 primary mutation. Most of the proposed secondary LHON mutations were rare in the Japanese population and they, except the 7444 mutation, may not influence the clinical features of LHON. 相似文献
5.
The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences. 相似文献
6.
MP Crump K Rajarathnam KS Kim I Clark-Lewis BD Sykes 《Canadian Metallurgical Quarterly》1998,273(35):22471-22479
The solution structure of the CCR3-specific chemokine, eotaxin, has been determined by NMR spectroscopy. The quaternary structure of eotaxin was investigated by ultracentrifugation and NMR, and it was found to be in equilibrium between monomer and dimer under a wide range of conditions. At pH = 5 and low ionic strength, eotaxin was found to be predominantly a monomer. The three-dimensional structure of the eotaxin monomer solved at pH 5.0 revealed that it has a typical chemokine fold, which includes a 3-stranded beta-sheet and an overlying alpha-helix. Except for the N-terminal residues (residues 1-8), the core of the protein is well defined. The eotaxin structure is compared with the chemokines regulated upon activation, normal T-cell expressed and secreted (RANTES) and monocyte chemoattractant protein-1 (MCP-1); eotaxin binds only CC chemokine receptor CCR3, whereas RANTES binds many receptors including CCR3, and MCP-1 binds a distinct receptor, CCR2. The RMSD of the eotaxin ensemble of structures with the RANTES average minimized monomeric subunit is 5.52 +/- 0.87 A over all backbone atoms and 1.14 +/- 0.09 A over backbone atoms of residues 11-28 and 34-65. The most important difference between the structures is in the N-terminal residues that are unstructured in eotaxin but structured in RANTES and MCP-1. Several residues in the loop region of RANTES show similar packing in eotaxin (residues 11-17). As the N-terminal and loop regions have been shown to be critical for receptor binding and signaling, this structure will be useful for determining the basis for CCR3 selectivity of the eotaxin. 相似文献
7.
PR Brakeman AA Lanahan R O'Brien K Roche CA Barnes RL Huganir PF Worley 《Canadian Metallurgical Quarterly》1997,386(6622):284-288
8.
S Halfon J Ford J Foster L Dowling L Lucian M Sterling Y Xu M Weiss M Ikeda D Liggett A Helms C Caux S Lebecque C Hannum S Menon T McClanahan D Gorman G Zurawski 《Canadian Metallurgical Quarterly》1998,273(26):16400-16408
We describe a new cystatin in both mice and humans, which we termed leukocystatin. This protein has all the features of a Class II secreted inhibitory cystatin but contains lysine residues in the normally hydrophobic binding regions. As determined by cDNA library Southern blots, this cystatin is expressed selectively in hematopoietic cells, although fine details of the distribution among these cell types differ between the human and mouse mRNAs. In addition, we have determined the genomic organization of mouse leukocystatin, and we found that in contrast to most cystatins, the leukocystatin gene contains three introns. The recombinant proteins corresponding to these cystatins were expressed in Escherichia coli as N-terminal glutathione S-transferase or FLAGTM fusions, and studies showed that they inhibited papain and cathepsin L but with affinities lower than other cystatins. The unique features of leukocystatin suggests that this cystatin plays a role in immune regulation through inhibition of a unique target in the hematopoietic system. 相似文献
9.
DA Vallera A Panoskaltsis-Mortari C Jost S Ramakrishnan CR Eide RJ Kreitman PJ Nicholls C Pennell BR Blazar 《Canadian Metallurgical Quarterly》1996,88(6):2342-2353
In a recent study, we showed that an immunotoxin (IT) made with a conventional monoclonal antibody targeting the CD3 epsilon moiety of the T-cell receptor (TCR) had a potent, but partial, graft-versus-host disease (GVHD) effect (Vallera et al, Blood 86:4367, 1995). Therefore, in this current study, we determined whether a fusion immunotoxin made with anti-CD3 single-chain Fv (sFv), the smallest unit of antibody recognizing antigen, would have anti-GVHD activity. A fusion protein was synthesized from a construct made by splicing sFv cDNA from the hybridoma 145-2C11 to a truncated form of the diphtheria toxin (DT390) gene. DT390 encodes a molecule that retains full enzymatic activity, but excludes the native DT binding domain. The DT390-anti-CD3sFv hybrid gene was cloned into a vector under the control of an inducible promoter. The protein was expressed in Escherichia coli and then purified from inclusion bodies. The DT390 moiety of the protein had full enzymatic activity compared with native DT and DT390-anti-CD3sFv, with an IC50 of 1 to 2 nmol/L against phytohemagglutinin-stimulated and alloantigen-stimulated T cells. Specificity was shown (1) by blocking the IT with parental anti-CD3 antibody, but not with a control antibody; (2) by failure of DT390-anti-CD3sFv to inhibit lipopolysaccharide-stimulated murine B cells; (3) by failure of an Ig control fusion protein, DT390-Fc, to inhibit T-cell responses; and (4) with in vivo immunohistochemisty studies. GVHD was studied in a model in which C57BL/6 (H-2b)-purified lymph node T cells were administered to major histocompatibility complex (MHC) antigen disparate unirradiated C.B.-17 scid (H-2d) mice to assess GVHD effects in the absence of irradiation toxicity. Flow cytometry studies showed that donor T cells were expanded 57-fold and histopathologic analysis showed the hallmarks of a lethal model of GVHD. Control mice receiving phosphate-buffered saline showed 17% survival on day 80 after bone marrow transplantation, and mice receiving 2 micrograms DT390-Fc fusion toxin control administered in 2 daily doses for 6 days (days 0 through 5) had a 43% survival rate. In contrast, 86% of mice receiving the same dose of DT390-anti-CD3sFv were survivors on day 80, a significant improvement, although survivors still showed histopathologic signs of GVHD. These findings suggest that new anti-GVHD agents can be genetically engineered and warrant further investigation of fusion proteins for GVHD treatment. 相似文献
10.
Alpha-difluoromethylornithine (DFMO) is commonly used as a specific ornithine decarboxylase (ODC, EC4.1.1.17) irreversible inhibitor. ODC is the enzyme responsible for polyamine biosynthesis, which has been shown to be strictly necessary for cell proliferation. In HT-29 Glc-/+ cells, L-arginine is the major precursor of these molecules through the sequential actions of arginase, which leads to L-ornithine generation and ODC. L-ornithine, a substrate for ODC, retroinhibits arginase. Since DFMO is an ornithine analogue, we searched for a direct effect of this agent upon arginase. The flux of L-arginine through arginase in intact cells was inhibited by 51+/-11% by 10 mM of DFMO whereas 10 mM of L-valine, a known potent arginase inhibitor, inhibited this flux by 73+/-6%. DFMO equilibrated between extracellular and intercellular spaces and, when used at 10-mM concentration, was without effect on L-arginine net uptake. Measurement of arginase activity in HT-29 cell homogenates with increasing concentrations of DFMO and L-arginine led to an inhibition with a calculated Ki (inhibitory constant) equal to 3.9+/-1.0 mM. L-ornithine was less effective than DFMO in inhibiting arginase activity. Bovine liver arginase, used as another source of the enzyme, was also severely inhibited by DFMO. The inhibitory effect of DFMO upon arginase, one step upstream of the ODC reaction in the metabolic conversion of L-arginine to polyamines, is of potential physiological importance, since it could alter the production of ornithine and thus its metabolism in pathways other than the ODC pathway. 相似文献
11.
RT Gandhi BK Chen SE Straus JK Dale MJ Lenardo D Baltimore 《Canadian Metallurgical Quarterly》1998,187(7):1113-1122
The mechanism by which HIV-1 induces CD4(+) T cell death is not known. A fundamental issue is whether HIV-1 primarily induces direct killing of infected cells or indirectly causes death of uninfected bystander cells. This question was studied using a reporter virus system in which infected cells are marked with the cell surface protein placental alkaline phosphatase (PLAP). Infection by HIV-PLAP of peripheral blood mononuclear cells (PBMCs) and T cell lines leads to rapid depletion of CD4(+) T cells and induction of apoptosis. The great majority of HIV-induced T cell death in vitro involves direct loss of infected cells rather than indirect effects on uninfected bystander cells. Because of its proposed role in HIV-induced cell death, we also examined the Fas (CD95/Apo1) pathway in killing of T cells by HIV-1. Infected PBMCs or CEM cells display no increase in surface Fas relative to uninfected cells. In addition, HIV-1 kills CEM and Jurkat T cells in the presence of a caspase inhibitor that completely blocks Fas-mediated apoptosis. HIV-1 also depletes CD4+ T cells in PBMCs from patients who have a genetically defective Fas pathway. These results suggest that HIV-1 induces direct apoptosis of infected cells and kills T cells by a Fas-independent mechanism. 相似文献
12.
CM Snapper F Rosas MA Moorman L Jin K Shanebeck DM Klinman MR Kehry JJ Mond CR Maliszewski 《Canadian Metallurgical Quarterly》1996,8(6):877-885
IFN-gamma has been shown to either stimulate or inhibit Ig secretion. No studies have yet addressed the basis for these seemingly conflicting properties nor whether IFN-gamma acted directly at the level of the B cell to mediate its effects. Thus, we studied the ability of IFN-gamma to regulate Ig secretion in sort-purified, resting murine B cells that were >99% Ig+, activated either through membrane Ig using unconjugated or dextran-conjugated anti-IgD antibodies (alphadelta-dex) or through CD40 using soluble or membrane CD40 ligand (CD40L). B cells activated with alphadelta-dex proliferated but do not secrete Ig, even in the presence of IL-1 + IL-2. We demonstrate that IFN-gamma only when added subsequent to B cell stimulation with alphadelta-dex, but not unconjugated anti-IfD antibody, plus IL-1 + IL-2 induces up to 100-fold enhancements in Ig secretion and in the numbers of Ig-secreting cells. The predominant Ig isotype secreted is IgM, with IgG3 and IgG2a comprising the majority of non-IgM antibody. IFN-gamma must act in concert with IL-2 for stimulation of Ig secretion. Further, IFN-gamma synergizes with IL-3 + granulocyte-macrophage colony stimulating factor for induction of Ig synthesis. IFN-gamma also enhances IgA syntheses by transforming growth factor-beta-induced membrane IgA+ cells. By contrast, 125IIFN-gamma fails to stimulate Ig secretion in B cells activated with CD40L in the presence or absence of IL-1 + IL-2 or IL-4. However, the combination of CD40L and alphabeta-dex is strongly synergistic for IFN-gamma-induced Ig secretion. Thus, these data establish that IFN-gamma can act directly on the B cell to induce Ig synthesis without the participation of any other cell and demonstrates that the mode of activation of the B cell plays an important role in directing the action of IFN-gamma. 相似文献
13.
EE Brooks NS Gray A Joly SS Kerwar R Lum RL Mackman TC Norman J Rosete M Rowe SR Schow PG Schultz X Wang MM Wick D Shiffman 《Canadian Metallurgical Quarterly》1997,272(46):29207-29211
The activity of cyclin-dependent kinase 2 (CDK2) is essential for progression of cells from G1 to the S phase of the mammalian cell cycle. CVT-313 is a potent CDK2 inhibitor, which was identified from a purine analog library with an IC50 of 0.5 microM in vitro. Inhibition was competitive with respect to ATP (Ki = 95 nM), and selective CVT-313 had no effect on other, nonrelated ATP-dependent serine/threonine kinases. When added to CDK1 or CDK4, a 8.5- and 430-fold higher concentration of CVT-313 was required for half-maximal inhibition of the enzyme activity. In cells exposed to CVT-313, hyperphosphorylation of the retinoblastoma gene product was inhibited, and progression through the cell cycle was arrested at the G1/S boundary. The growth of mouse, rat, and human cells in culture was also inhibited by CVT-313 with the IC50 for growth arrest ranging from 1.25 to 20 microM. To evaluate the effects of CVT-313 in vivo, we tested this agent in a rat carotid artery model of restenosis. A brief intraluminal exposure of CVT-313 to a denuded rat carotid artery resulted in more than 80% inhibition of neointima formation. These observations suggest that CVT-313 is a promising candidate for evaluation in other disease models related to aberrant cell proliferation. 相似文献
14.
15.
M Loughnan T Bond A Atkins J Cuevas DJ Adams NM Broxton BG Livett JG Down A Jones PF Alewood RJ Lewis 《Canadian Metallurgical Quarterly》1998,273(25):15667-15674
We have isolated and characterized alpha-conotoxin EpI, a novel sulfated peptide from the venom of the molluscivorous snail, Conus episcopatus. The peptide was classified as an alpha-conotoxin based on sequence, disulfide connectivity, and pharmacological target. EpI has homology to sequences of previously described alpha-conotoxins, particularly PnIA, PnIB, and ImI. However, EpI differs from previously reported conotoxins in that it has a sulfotyrosine residue, identified by amino acid analysis and mass spectrometry. Native EpI was shown to coelute with synthetic EpI. The peptide sequence is consistent with most, but not all, recognized criteria for predicting tyrosine sulfation sites in proteins and peptides. The activities of synthetic EpI and its unsulfated analogue [Tyr15]EpI were similar. Both peptides caused competitive inhibition of nicotine action on bovine adrenal chromaffin cells (neuronal nicotinic ACh receptors) but had no effect on the rat phrenic nerve-diaphragm (muscle nicotinic ACh receptors). Both EpI and [Tyr15]EpI partly inhibited acetylcholine-evoked currents in isolated parasympathetic neurons of rat intracardiac ganglia. These results indicate that EpI and [Tyr15]EpI selectively inhibit alpha3beta2 and alpha3 beta4 nicotinic acetylcholine receptors. 相似文献
16.
JA Kaleeba H Offner AA Vandenbark A Lublinski AD Weinberg 《Canadian Metallurgical Quarterly》1998,10(4):453-461
The OX-40 receptor, a member of the nerve growth factor/tumor necrosis factor receptor gene family, is expressed preferentially on autoreactive CD4+ T cells isolated from the site of inflammation in rats with clinical signs of experimental autoimmune encephalomyelitis (EAE). To examine whether the OX-40 receptor has biologic relevance to T cell function, we evaluated the ability of a rat OX-40 receptor-specific antibody to co-stimulate a myelin basic protein (MBP)-reactive CD4+ T cell line. The anti-OX-40 antibody provided a potent co-stimulatory signal to CD4+ T cells when added in conjunction with a submitogenic dose of anti-CD3, but the anti-OX-40 antibody alone did not produce a mitogenic response. The magnitude and dose-response of anti-OX-40 co-stimulation was virtually identical to the signal delivered to T cells when cultured with anti-CD28 in conjunction with anti-CD3. MBP-specific T cells stimulated with both anti-CD3 and anti-OX-40 antibodies expressed increased mRNA and protein for IL-2 when compared to anti-CD3 alone. MBP-specific T cells stimulated with both anti-CD3 and anti-OX-40 antibodies were also able to induce EAE when transferred into naive Lewis rats. In contrast, cells stimulated with anti-CD3 alone were not encephalitogenic. These data suggest that the function of the OX-40 receptor on activated T cells is to provide an alternative pathway for T cell co-stimulation that may be similar in potency to the CD28-mediated signal. 相似文献
17.
R Hegde SM Srinivasula M Ahmad T Fernandes-Alnemri ES Alnemri 《Canadian Metallurgical Quarterly》1998,273(14):7783-7786
We identified and cloned a novel murine member of the pro-apoptotic Bcl-2 family. This protein, designated Blk, is structurally and functionally related to human Bik and localized to the mitochondrial membrane. Blk contains a conserved BH3 domain and can interact with the anti-apoptotic proteins Bcl-2 and Bcl-xL. Ectopic expression of Blk in mammalian cells induces apoptosis, which can be inhibited by mutations in the BH3 domain and by overexpression of Bcl-2 or Bcl-xL but not by CrmA. The apoptotic activity of Blk is also inhibited by a dominant negative caspase-9, suggesting that Blk induces apoptosis through activation of the cytochrome c-Apaf-1-caspase-9 pathway. 相似文献
18.
M Shelly R Pinkas-Kramarski BC Guarino H Waterman LM Wang L Lyass M Alimandi A Kuo SS Bacus JH Pierce GC Andrews Y Yarden 《Canadian Metallurgical Quarterly》1998,273(17):10496-10505
The ErbB signaling network consists of four transmembrane receptor tyrosine kinases and more than a dozen ligands sharing an epidermal growth factor (EGF) motif. The multiplicity of ErbB-specific ligands is incompletely understood in terms of signal specificity because all ErbB molecules signal through partially overlapping pathways. Here we addressed the action of epiregulin, a recently isolated ligand of ErbB-1. By employing a set of factor-dependent cell lines engineered to express individual ErbBs or their combinations, we found that epiregulin is the broadest specificity EGF-like ligand so far characterized: not only does it stimulate homodimers of both ErbB-1 and ErbB-4, it also activates all possible heterodimeric ErbB complexes. Consistent with its relaxed selectivity, epiregulin binds the various receptor combinations with an affinity that is approximately 100-fold lower than the affinity of ligands with more stringent selectivity, including EGF. Nevertheless, epiregulin's action upon most receptor combinations transmits a more potent mitogenic signal than does EGF. This remarkable discrepancy between binding affinity and bioactivity is permitted by a mechanism that prevents receptor down-regulation, and results in a weak, but prolonged, state of receptor activation. 相似文献
19.
This report tests the hypothesis that intravascular prehydration with 3% gelatin in electrolyte solution maintains arterial blood pressure after spinal anesthesia better than with an equal volume of isotonic saline solution. Thirty-four patients undergoing elective transurethral resection of the prostate were allocated randomly to receive either 7 mL/kg of isotonic saline 0.9% (17 patients) or 7 mL/kg of 3% gelatin in electrolyte solution (17 patients) before spinal anesthesia. There was a significant increase in central venous pressure in the gelatin group without any significant change in the isotonic saline group. After spinal anesthesia, the mean systolic blood pressure significantly decreased in both groups; however, the incidence of systolic blood pressure greater than 75% of control value was higher in the gelatin group (15/17) than in the normal saline group (9/17). Also, the mean dose of phenylephrine required to maintain arterial blood pressure > 75% of the baseline value was significantly larger in the normal saline group than in the gelatin group. We conclude that prophylactic administration of gelatin is more effective than saline in attenuating spinal anesthesia-induced hypotension. 相似文献
20.
A 60 nt long RNA termed IRNA, isolated from the yeast Saccharomyces cerevesiae, was previously shown to selectively block internal ribosome entry site (IRES)-mediated translation without interfering with cap-dependent translation of cellular mRNAs both in vivo and in vitro. IRNA specifically bound cellular proteins believed to be important for IRES-mediated translation. We demonstrate here that a complementary copy of IRNA (cIRNA) is also active in blocking IRES-mediated translation and that it binds many of the same cellular proteins that IRNA does. We have probed the secondary structure of both IRNA and cIRNA using single-strand- and double-strand-specific nucleases as well as using oligonucleotide hybridization followed by RNase H digestion. Both IRNA and cIRNA share secondary structural homology, although distinct differences do exist between the two structures. Mutational analysis of IRNA shows that sequences that form both the main stem and one loop are critical for its translation inhibitory activity. Maintenance of the established secondary structure appears to be required for both IRNA's ability to bind cellular trans -acting proteins believed to be required for IRES-mediated translation and its ability to block IRES-mediated translation. 相似文献