Toxigenic fungi associated with processed (green) coffee beans (Coffea arabica L.)

Processed (green) coffee beans from Coffea arabica in Brazil were assessed for the presence of Aspergillus and Penicillium species both before and after surface sterilisation, the aflatoxigenic and ochratoxigenic potential of the isolates and ochratoxin A levels. Contamination by Aspergillus and Penicillium species was found on 96% and 42%, respectively, of 45 samples from 11 localities. After disinfection with 1% sodium hypochlorite, the levels fell to 47% and 24%, respectively. One hundred and eighty isolates were identified to species level and comprised Aspergillus sections Circumdati (10 species), Flavi (3), Nigri (3), Versicolores (4), while two were teleomorphic species. Eight species of Penicillium were isolated. Within section Circumdati, 75% of the isolates produced ochratoxin A and all except Aspergillus elegans and Aspergillus insulicola have previously been reported to produce ochratoxin A. One-third of the 18 isolates of Aspergillus flavus produced aflatoxin B1 and B2. None of the isolates belonging to Aspergillus section Nigri or Penicillium produced ochratoxin A. Of the 40 bean samples analysed, 58% were infected with potentially ochratoxigenic fungi but only 22% of these were contaminated with ochratoxin A at levels that varied from 0.47 to 4.82 ng/g, with an average contamination level of 2.45 ng/g.     

Aspergillus carbonarius as the main source of ochratoxin A contamination in dried vine fruits from the Spanish market

Ochratoxin A (OTA) can occur in a wide range of foods, but unexpectedly high concentrations have been detected in dried vine fruits of various origins. The European Union has recently established a maximum OTA limit of 10 microg/kg for these foodstuffs. In order to determine the likely origin of OTA, a mycological study of 50 dried fruit samples (currants, raisins, and sultanas) representative of the Spanish market was conducted. Fungal contamination was detected in 49 of 50 (98%) samples. Black aspergilli were isolated from all of the positive samples. Aspergillus niger var. niger was isolated from 98% of the samples, and Aspergillus carbonarius was found in 58% of the samples. One hundred sixty-eight A. niger var. niger isolates and 91 A. carbonarius isolates were screened for their ability to produce OTA. Eighty-eight (96.7%) A. carbonarius isolates and one (0.6%) A. niger var. niger isolate were found to be OTA producers. Black aspergilli were the dominant fungi. Among black aspergilli, A. carbonarius has shown a consistent ability to produce OTA and is the most probable source of this mycotoxin in these substrates.     

Fumonisin B2 production by Aspergillus niger in Thai coffee beans

During 2006 and 2007, a total of 64 Thai dried coffee bean samples (Coffea arabica) from two growing sites in Chiangmai Province and 32 Thai dried coffee bean samples (Coffea canephora) from two growing sites in Chumporn Province, Thailand, were collected and assessed for fumonisin contamination by black Aspergilli. No Fusarium species known to produce fumonisin were detected, but black Aspergilli had high incidences on both Arabica and Robusta Thai coffee beans. Liquid chromatography (LC) with high-resolution mass spectrometric (HRMS) detection showed that 67% of Aspergillus niger isolates from coffee beans were capable of producing fumonisins B₂ (FB₂) and B₄ when grown on Czapek Yeast Agar with 5% NaCl. Small amounts (1–9.7 ng g^?1) of FB₂ were detected in seven of 12 selected coffee samples after ion-exchange purification and LC–MS/MS detection. Two samples also contained FB₄. This is the first record of freshly isolated A. niger strains producing fumonisins and the first report on the natural occurrence of FB₂ and FB₄ in coffee.     

Occurrence of ochratoxin A in wine and ochratoxigenic mycoflora in grapes and dried vine fruits in South America

Grape and wine production in South America represents about 6.6% and 10% respectively of the world grape and wine production. The available information on the ochratoxigenic mycoflora and ochratoxin A (OTA) presence in wine grapes, wines, grape juices and dried vine fruits is limited. Surveys have been carried out in Argentina and Brazil which showed that Aspergillus niger aggregate are predominant in the Argentinean varieties while from the Brazilian varieties the species A. niger, Aspergillus ochraceus and Aspergillus carbonarius were isolated. A mycobiota survey from wine grapes in Argentina showed that while Alternaria alternata was predominant, Aspergillus section Nigri species were isolated from 60% of samples. About 41% of black Aspergilli isolates produced OTA with levels ranging from 2 to 24.5 ng mL(-1). In another study, about 83% of A. carbonarius isolates from dried vine fruits produced OTA, with levels ranging from 2 to 5200 ng mL(-1). A survey of grape juices and wines of Brazilian, Argentinean and Chilean origin were found to contain very low levels of OTA. Studies are in progress in Latin America on the ecophysiology of ochratoxigenic fungi and OTA occurrence to reduce the impact of this toxin in the food chain.     

A polyphasic approach to the identification of ochratoxin A-producing black Aspergillus isolates from vineyards in Sicily

Aspergillus strains belonging to section Nigri isolated during a two year survey in eight Sicilian vineyards located on the slopes of Mount Etna (Sicily, Italy) were analysed analyzed in order to characterize species responsible for ochratoxin A (OTA) contamination of grapes. The polyphasic approach permitted analysis of biodiversity of Aspergillus isolates in relation to their morphology, ochratoxigenicity and genetic variability. We assessed OTA production by A. carbonarius, A. niger, A. tubingensis and A. japonicus using an enzyme-linked immunosorbent assay. A. carbonarius isolates were the strongest OTA producers. A subset of 66 representative strains was selected for further DNA-based characterization. PCR assays using species-specific primers discriminated between A. niger, A. carbonarius and A. japonicus on the basis of the target sequences for each species. The PCR-based methods matched morphological characterization in identifying all the black aspergilli (BA) isolates tested, whereas RFLP analysis with RsaI of isolates positive to PCRs with A. niger specific primers identified three A. tubingensis isolates. The identification of thirteen isolates was further confirmed by ITS analysis. By this method, each of the isolates was identified and assigned to an Aspergillus species. The fAFLP analysis of 40 isolates highlighted the power of this technique to discriminate different species and single strains, to verify the presence of mixed populations in the same vineyard, through homogeneous species clusters. No correlation was observed between the clusters and OTA production level or origin.     

Toxigenic fungi isolated from dried vine fruits in Argentina

To evaluate the potential for mycotoxin production by fungi in dried vine fruits, the mycobiota was determined both before and after surface disinfection. Predominant genera were Aspergillus (50.2%), Eurotium (21.4%) and Penicillium (13.5%). Aspergillus section Nigri ("black aspergilli") were isolated with relatively high frequency. Aspergillus niger was the most common species but only 3 of 293 isolates screened were ochratoxin A (OTA) producers. Aspergillus carbonarius was less common but 96% of 48 strains screened were ochratoxigenic. OTA was not produced by A. japonicus. Other toxigenic fungi detected were A. ochraceus (3 strains produced OTA), Aspergillus flavus (5 strains produced cyclopiazonic acid but not aflatoxins), P. citrinum (19 strains were strong citrinin producers) and Alternaria alternata (15 strains were producers of tenuazonic acid, alternariol and alternariol methyl ether). In spite of the high incidence of A. carbonarius capable of producing OTA, low levels of this toxin were detected in the samples analysed.     

Occurrence of ochratoxin A-producing fungi in grapes grown in Italy

A study was carried out to investigate fungi present on grapes grown in Italy. Aspergillus and Penicillium spp. isolates were identified and studied in vitro, and their ability to produce ochratoxin A (OA) was investigated. The survey involved nine vineyards, three located in northern Italy and six located in southern Italy. In 1999 and 2000, bunches of grapes at different growth stages were collected from all nine vineyards, and berry samples were placed in moist chambers and incubated. The resultant fungal colonies were then transferred to petri dishes containing Czapek yeast agar and incubated at 25 degrees C for 7 days; the fungal isolates were identified and then cultivated in liquid Czapek yeast medium and evaluated for their ability to produce OA. During the survey, 508 isolates were collected, with 477 belonging to Aspergillus spp. and 31 belonging to Penicillium spp. Among the aspergilli, species of the Fumigati, Circumdati, and Nigri sections were identified, with species of the Nigri section (464 isolates) largely predominating; for species of the Nigri section, 108 isolates were uniseriate, 270 were biseriate, and 86 were identified as Aspergillus carbonarius. Black aspergilli isolated over the 2 years of the study showed a very similar pattern. On average, the biseriates represented about 60% of the isolates collected in both years and were followed by uniseriates (21%) and A. carbonarius (19%). The most toxigenic strains proved to be those of A. carbonarius; about 60% of these isolates were OA producers and produced the highest levels of OA. A. carbonarius was more frequent in the south, but in both areas the percentages of OA-producing isolates remained the same.     

Occurrence of fruit rot fungi (Aspergillus section Nigri) on some drying varieties of irrigated grapes

The occurrence of Aspergillus section Nigri on certain varieties of grapes used for dried vine fruit (and especially on Sultana), was surveyed extensively during three harvest seasons (1998, 1999 and 2000). Members of Aspergillus section Nigri were enumerated and identified in a total of 806 samples comprising both fresh fruit as well as partially-dried and fully-dried grapes. Aspergillus aculeatus , A. carbonarius and A. niger were commonly isolated. Of those three species, A. niger showed the highest optimum temperature for growth, as well as highest thermal tolerance. That combination of properties probably accounts for the occurrence of A. niger in over 80% of fruit samples in all three seasons. A. carbonarius was also prevalent on fruit surveyed for fungal rots. Severity of infection with this group of fungi was highest in the seasons when grape berries were rain-damaged. Typically, the Aspergillus count increased during the initial stages of drying. Growth of these moulds while grapes are either still on the vine or during drying carries important implications for human consumption due to the potential for certain strains of these fungi to produce ochratoxin A. Fungal cultures on coconut cream agar plates were screened for production of ochratoxin A via fluorescence emission under UV light. Such fluorescence was observed in all isolates of A. carbonarius , but was not observed in any isolates of either A. aculeatus or A. niger .     

Current importance of ochratoxin A-producing Aspergillus spp

Ochratoxin A (OA) is receiving attention worldwide because of the hazard it poses to human and animal health. OA contamination of commodities, such as cereals or pork and poultry meat, is well recognized. Nevertheless, there is an increasing number of articles reporting OA contamination in other food commodities, such as coffee, beer, wine, grape juice, and milk, in the last few years. This continuous and increasing exposure to OA that humans experience is reflected in the high incidence of OA in both human blood and milk in several countries. OA was believed to be produced only by Aspergillus ochraceus and closely related species of section Circumdati and by Penicillium verrucosum; however, in the genus Aspergillus, the production of OA has been recently reported by species outside the section Circumdati. Thus, it has been clearly established as a metabolite of different species of the section Nigri, such as Aspergillus niger and Aspergillus carbonarius. OA production ability by Aspergillus spp. is more widespread than previously thought; therefore, there is the possibility that unexpected species can be new sources of this mycotoxin in their natural substrates.     

Occurrence of ochratoxin A producing fungi in wine and table grapes in Israel

A 3-year survey was conducted to assay the number of Aspergillus Section Nigri isolates and in vitro ochratoxin A (OTA) production capacity in 10 vineyards in Israel. The survey included field sampling of two wine cultivars, 'Sauvignon Blanc' and 'Cabernet Sauvignon' as well as the table grape cultivar 'Superior'. A total of 2114 isolates were analyzed and of those 161 isolates were shown to produce OTA. The major finding was that Aspergillus carbonarius (336 tested strains) is the most consistent producer of OTA, with approximately 35% of the isolates identified as positive in vitro. In comparison, 3.1% of other isolates from the Aspergillus niger aggregate (of 1432 strains) produced OTA in vitro. In contrast, none of the 346 tested strains with a uniseriate head morphology produced OTA. The incidence of infected berries was very low before veraison, while at harvest, this frequency was twice as high. In general, the composition of black Aspergilli did not differ during berry development. Generally, more OTA-producing isolates were isolated from the surface of table grapes cv. 'Superior' compared to 'Sauvignon Blanc'. None of the samples collected at harvest contained traces of OTA in the juice. This study shows that grapes in Israel are contaminated with ochratoxigenic species which represent a risk of OTA contamination.     

Effect of intra and interspecific interaction on OTA production by A. section Nigri in grapes during dehydration

The aim of this study was to assess the colonizing capability and OTA production of different populations of Aspergillus section Nigri spp. in grapes, as affected by the interactions with other fungi, during a simulated in vitro sun-drying. Mature white grapes were divided into two lots of healthy and artificially injured grapes and inoculated with A. section Nigri spp. (A. carbonarius OTA producer, A. niger aggregate OTA producer, A. niger aggregate OTA non-producer), Eurotium amstelodami and Penicillium janthinellum, in different combinations. The drying process was simulated adjusting water activity firstly at 0.98 a(w) and gradually decreasing it to 0.76 a(w) for a total of 20 days. Colonizing grape percentages were recorded after 5, 10, 15 and 20 days of dehydration and OTA content was measured after 5, 7, 10, 12, 15, 17 and 20 days. Colonization of grapes increased with time in all treatments. A. niger aggregate OTA-positive showed the highest colonization percentage, followed by A. carbonarius, and finally their mixed inoculum. When the two OTA-producing strains were combined, addition of any other microorganism increased the percentage of infection by A. section Nigri. A. carbonarius was the highest OTA producer in pure culture, followed by A. niger aggregate OTA-positive. In general, when competing fungi were added to A. carbonarius inoculum, the OTA content was reduced. E. amstelodami was the only competing fungus which increased OTA accumulation. The sun-drying process may be conducive to OTA accumulation in dried grapes. The complex fungal interactions which may take place during this process, may act as an additional control factor, given that the higher presence of A. niger aggregate OTA-negative inhibits OTA accumulation by OTA producing species.     

Aspergillus spp., distribution, population composition and ochratoxin A production in wine producing vineyards in Greece

Vineyard surveys of 11 wine producing grape cultivars, were carried out in sixteen vineyards, in five winemaking regions in Greece, during 2002 and 2003. The occurrence of various Aspergillus spp. in bunches of berries at setting, veraison and ripening at harvest time was investigated. Aspergillus niger aggregate and A. carbonarius were predominantly isolated from sampled berries. Although the prevailing Aspergillus spp. isolates belonged to A. niger aggregate, isolates of A. carbonarius were the most efficient ochratoxin A (OTA) producers. Of 50 tested isolates of A. carbonarius 42% produced amounts of OTA, exceeding 25 ppb, while none of the 85 isolates of A. niger aggregate tested produced above 16 ppb.     

Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.     

Occurrence of ochratoxigenic fungi and ochratoxin A in grapes from a Tunisian vineyard

The occurrence of ochratoxin A (OTA) and the identification of the ochratoxigenic microbiota in Tunisian grapes were studied for the first time. Black aspergilli were the dominant genus among the filamentous fungi isolated from grapes and were the only potential OTA-producing fungi found. The most abundant species were member of Aspergillus niger aggregate (63%) and Aspergillus carbonarius (36%). Uniseriate aspergilli were rarely present (1%). Of the A. carbonarius isolates, 97% were OTA positive but only 3% of the A. niger aggregate isolates were OTA positive. During grape maturation, the frequency of black aspergilli increased due to increase of the numbers of A. carbonarius. Musts (n=24) obtained from grapes collected at the different sampling times were analyzed for their OTA content. Up to 37% of the musts contained OTA at levels varying between 0.59 and 2.57 microg/l. The amounts of OTA in musts increased as grapes matured. These results indicate that A. carbonarius is the main cause of OTA contamination of Tunisian grapes.     

Ochratoxin A and Aspergillus section Nigri in peanut seeds at different months of storage in Córdoba, Argentina

Peanut is an important food commodity in Argentina. Last year Córdoba Province accounted for approximately 96% of the total Argentinian production. Few surveys of peanuts for the natural occurrence of ochratoxins and ochratoxin-producing fungi have been reported. The objectives of this study were to investigate the occurrence of Aspergillus section Nigri and ochratoxin A (OTA) in storage peanuts during a three-month-period. The capacity to produce OTA by Aspergillus section Nigri was also studied. A total of 100 samples were collected from May to July 2004. The frequency of contaminating fungi were determined by surface-disinfection the seeds and plating onto several agar types. Detection of OTA in seed samples was performed using an HPLC method. Strains belonging to Aspergillus section Nigri or Flavi were detected in all seeds samples. From the section Nigri, the species belonging to A. niger aggregate were isolated in 100% of the samples. The main ochratoxigenic specie, A. carbonarius, was present at low levels throughout the study period. OTA was found in 50% of the peanut samples, with mean levels ranging from 5.6 to 130 ng g(-1). The mean value of OTA obtained after the first month of storage (30 ng g(-1)) was significantly higher from those obtained after the second (6.5 ng g(-1)) and third (13 ng g(-1)) month (p<0.0001). One hundred and four (32%) of 322 strains of Aspergillus section Nigri, were OTA producers. The levels of toxin produced ranged from 2 to 24 ng ml(-1) of culture medium (mean level: 12.7 ng ml(-1)). These results indicate that humans and animals being may be frequently exposed to OTA in Argentina through the ingestion of peanut seed and foods based on peanuts. The presence of this toxin in peanuts might be an appropriate focus for future studies to estimate exposure through normal consumption of this commodity. These data are important in formulating guidelines for quality control of peanuts in Argentina.     

Ochratoxin A in red paprika: relationship with the origin of the raw material

The occurrence of ochratoxin A (OA) in paprika elaborated from peppers grown in several countries (Peru, Brazil, Zimbabwe and Spain) was studied, using an immunoaffinity clean-up column coupled to liquid chromatography and fluorescence detection. The preparation of the methyl ester (OA-Me) and liquid chromatography-electrospray-ion trap-mass spectrometry was used both to confirm the identity of the chromatographic peak that correspond to OA and to quantify it at low levels or in dirty fractions. A total of 115 strains of moulds were isolated; 85 of the fungal strains were obtained from OA contaminated paprika samples and identified as belonging to the Aspergillus Section Circumdati group (A. ochraceus) and Section Nigri group (A. niger, A. carbonarius). Among the latter ones, 31% of the A. ochraceus isolates and one A. niger were OA producers in vitro. None of the mould strains isolated from paprika samples with undetectable levels of OA or concentrations below 1 microg kg(-1) were toxin producers. Great differences in OA content in paprika samples were found, and a relationship with the climatic conditions of the geographic origin of the samples, and with cultural and technical practices in pepper manipulation is suggested.     

Water activity and temperature effects on growth of Aspergillus niger, A. awamori and A. carbonarius isolated from different substrates in Argentina

The objectives of this study were to determine the effect of water activity, temperature, and their interactions on a) mycelial growth rate and b) the lag phase prior to grow of seven isolates of Aspergillus section Nigri isolated from peanuts, maize kernels, dried grapes and coffee cherries from Argentina. Three Aspergillus niger, three A. awamori and one A. carbonarius isolates examined showed optimum a(W) level for growth at 0.97 with optimal temperature of 30 degrees C. for most of the isolates and 25 degrees C for only one (A. awamori RCP176). Minimal a(W) for growth was 0.85 at the highest temperature tested. Overall growth was reduced up to 50% at 0.93 a(W). Growth was also to a large extend inhibited at 0.85 a(W) for most isolates even after 21 days of incubation at temperatures lower than 30 degrees C. The analysis of variance of the effect of single (isolate, a(W) and temperature), two- and three-way interaction showed that all factors alone and all interactions were statistically significant (P<0.001) in relation to growth rates and lag phase for A. niger, A. awamori and A. carbonarius isolates. These data are relevant since these species are isolated in high frequency on numerous substrates for human and animal consumption in Argentina.     

Mycoflora and ochratoxin A producing strains of Aspergillus in Algerian wheat

Wheat is a basic staple food for very large segments of the population of Algeria. The aim of this study is to analyse ochratoxin A (OTA)-producing mould and OTA-contaminated wheat. To evaluate the mycoflora and the potential for OTA production by Aspergillus strains, a total of 85 samples of wheat destined for human consumption were collected from two regions in Algeria (Tizi Ouzou and Setif) during the following phases: preharvest, storage in silos, and after processing. The mean value counts of fungi ranged from 275 to 1277 CFU g(-1). The dominant genus was Aspergillus, predominantly A. flavus, A. niger and A. versicolor. The other isolated species were A. ochraceus, A. alliaceus, A. carbonarius, A. terreus, A. fumigatus, A. candidus and Aspergillus spp. The occurrence and the levels of the genus Penicillium, Fusarium, Alternaria and Mucor were substantially lower than those of Aspergillus. The storage in silos shows high levels of Aspergillus (66 to 84%), especially A. flavus, but A. niger and other fungi were isolated at relatively low percentages. Equal distribution of the fungal contamination into the bran, flour and semolina fractions was observed from Flour Mill and Semolina Mill. The genus Aspergillus remained present at high levels at several phases of the production process. In addition, the ability to produce OTA by 135 isolates belonging to eleven species of Aspergillus and 23 isolates of Penicillium spp. was analyzed using fluorescent detection-based HPLC. Thus, it was found that 51 isolates (32.3%) were ochratoxigenic. All isolated strains of A. ochraceus (12) and A. alliaceus (6) produced OTA at concentrations ranging from 0.23 to 11.50 microg g(-1). Most of the A. carbonarius strains (80%) were OTA producers (0.01 to 9.35 microg g(-1)), whereas A. terreus (50%), A. niger (28%), A. fumigatus (40%), A. versicolor (18%) and Penicillium spp. (21.7%) were low level producers (0.01 to 0.07 microg g(-1)). The concentration of OTA was determined in 30 samples of wheat. OTA was detected in 12 (40%) of the samples at levels ranging from 0.21 to 41.55 microg kg(-1).     

Changes on the levels of serotonin precursors – tryptophan and 5-hydroxytryptophan – during roasting of Arabica and Robusta coffee

The levels of free and total tryptophan and of 5-hydroxytryptophan (5-HTP) were investigated in green and roasted grains and beverages of Coffea arabica L. (Arabica) and Coffea canephora Pierre var. robusta (Robusta). Grains were light, medium and dark roasted. Free and protein tryptophan were extracted before and after hydrolysis. The levels of tryptophan and 5-HTP were quantified simultaneously by ion-pair HPLC and fluorimetric detection after derivatisation with o-phthalaldehyde. Robusta green coffee had higher total and protein tryptophan, whereas Arabica had higher free tryptophan levels. 5-HTP was not detected in the samples before and after roasting. Free tryptophan was completely degraded during roasting. Roasting significantly affected protein tryptophan. The rate of loss was smaller in Arabica compared to Robusta at every roasting degree. A beverage prepared the Brazilian way with a medium-roasted coffee provided 1.4–2.5 mg tryptophan/50 ml cup.     

Fungal colonization and biochemical changes in coffee beans undergoing monsooning

Changes in the mycofloral composition and concentrations of proteins, reducing sugars, phenols and tannins in coffee beans were analysed during different weeks of monsooning in Coffea arabica L. (Arabica) and C. canephora Pierre ex Froehner (Robusta). The highest fungal populations occurred during the fourth to seventh week of the monsooning process and the dominant fungal species were Aspergillus niger, Aspergillus tamarii, Aspergillus candidus, Penicillium spp. and Absidia heterospora. The protein and reducing sugar content increased steadily while the tannin content decreased beyond the detectable limit during monsooning. The phenolic content, however, was found to decline in the case of Robusta and increase slightly in Arabica. Throughout the study the monsooned coffee beans had different mycoflora and varied biochemical composition compared to non-monsooned coffee beans.