Regulation by nutrition and age of insulin-like growth factor binding sites in ovine kidney

A combined NMR-molecular dynamics approach has been applied to determine the solution structure of a truncated analogue of the Bombyx mori telomeric d(TTAGG) single repeat sequence in Na+ cation-containing aqueous solution. The two-fold symmetric four-stranded d(TAGG) quadruplex contains two adjacent G(syn).G(syn).G(anti).G(anti) G-tetrads sandwiched between novel (T.A).A triads with individual strands having both a parallel and antiparallel neighbour around the quadruplex. The (T.A).A triad represents the first experimental verification of a base triad alignment which constitutes a key postulate in the recently proposed model of triad-DNA. Further, the (T.A).A triad is generated by positioning an A residue through hydrogen bonding in the minor groove of a Watson-Crick T.A base pair and includes a T-A platform related to an A-A platform recently observed in the structure of the P4-P6 domain of the Tetrahymena self splicing group I ribozyme. The novel architecture of the truncated Bombyx mori quadruplex structure sets the stage for the design and potential identification of additional base tetrads and triads that could participate in pairing alignments of multi-stranded DNA structures during chromosome association and genetic recombination.     

Characteristics of insulin receptor binding to various rat tissues

The solution secondary structure of the Oxytricha nova telomeric 3' overhang, d(T4G4)2, has been investigated by Raman spectroscopy, hydrogen-deuterium exchange kinetics and gel electrophoresis. The electrophoretic mobility of d(T4G4)2 in non-denaturing gels indicates a highly compact conformation, consistent with a hairpin secondary structure. Raman markers show that the d(T4G4)2 hairpin contains equal numbers of C2'-endo/syn and C2'-endo/anti deoxyguanosine conformers, as well as G.G base-pairs of the Hoogsteen type. The hydrogen-deuterium exchange kinetics of d(T4G4)2, monitored by time-resolved Raman spectroscopy, reveal two kinetically distinct classes of guanine imino (N1H) protons. The more slowly exchanging fraction (kN1H(1)=4.6x10(-3) min-1), which represents 50% of N1H groups, is attributed to Hoogsteen-paired residues. The more rapidly exchanging fraction (kN1H(2)>/=0.3 min-1) is attributable to solvent-exposed residues. Raman dynamic probe of the kinetics of guanine C8H-->C8(2)H exchange in d(T4G4)2 reveals modest retardation vis-à-vis dGMP, which rules out quadruplex formation by the telomeric repeat and confirms an ordered secondary structure consistent with a Hoogsteen-paired hairpin. Similar Raman, hydrogen-isotope exchange and electrophoretic mobility experiments on the related telomeric model, dT6(T4G4)2, also reveal a hairpin stabilized by Hoogsteen G.G pairs. Presence of the 5' thymidine tail preceding the Oxytricha telomeric repeat has no apparent effect on the hairpin secondary structure. We propose a molecular model for the hairpin conformation of the Oxytricha nova telomeric repeat and consider its possible roles in mechanisms of telomeric DNA interaction in vitro and telomere function in vivo.     

Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA

We have applied NMR and molecular dynamics computations including intensity based refinement to define the structure of the d(G-G-G-C-T4-G-G-G-C) dodecanucleotide in 100 mM NaCl solution. The G-G-G-C sequence is of interest since it has been found as tandem repeats in the DNA sequence of human chromosome 19. The same G-G-G-C sequence is also seen as islands in adeno-associated virus, a human parvovirus, which is unique amongst eukaryotic DNA viruses in its ability to integrate site-specifically into a defined region of human chromosome 19. The d(G-G-G-C-T4-G-G-G-C) sequence forms a quadruplex in Na cation containing solution through head-to-tail dimerization of two symmetry-related stem-hairpin loops with adjacent strands antiparallel to each other around the quadruplex. The connecting T4 loops are of the lateral type, resulting in a quadruplex structure containing two internal G.G.G.G tetrads flanked by G.C.G.C tetrads. The G(anti).G(syn).G(anti).G(syn) tetrads are formed through dimerization associated hydrogen bonding alignments of a pair of Hoogsteen G(anti).G(syn) mismatch pairs, while the G(anti).C(anti).G(anti).C(anti) tetrads are formed through dimerization associated bifurcated hydrogen bonding alignments involving the major groove edges of a pair of Watson-Crick G.C base-pairs. The quadruplex contains two distinct narrow and two symmetric wide grooves with extensive stacking between adjacent tetrad planes. The structure of the quadruplex contains internal cavities that can potentially accommodate Na cations positioned between adjacent tetrad planes. Three such Na cations have been modeled into the structure of the d(G-G-G-C-T4-G-G-G-C) quadruplex. Finally, we speculate on the potential role of quadruplex formation involving G.G.G.G and G.C.G.C tetrads during the integration of the adeno-associated parvovirus into its target on human chromosome 19, both of which involve stretches of G-G-G-C sequence elements.     

The SV40 large T-antigen helicase can unwind four stranded DNA structures linked by G-quartets

We describe a novel activity of the SV40 large T-ag helicase, the unwinding of four stranded DNA structures linked by stacked G-quartets, namely stacked groups of four guanine bases bound by Hoogsteen hydrogen bonds. The structures unwound by the helicase were of two types: (i) quadruplexes comprising four parallel strands that were generated by annealing oligonucleotides including clustered G residues in a buffer containing Na+ions. Each parallel quadruplex consisted of four oligonucleotide molecules. (ii) Complexes comprising two parallel and two antiparallel strands that were generated by annealing the above oligonucleotides in a buffer containing K+ions. Each antiparallel complex consisted of two folded oligonucleotide molecules. Unwinding of these unusual DNA structures by the T-ag was monitored by gel electrophoresis. The unwinding process required ATP and at least one single stranded 3'-tail extending beyond the four stranded region. These data indicated that the T-ag first binds the 3'-tail and moves in a 3'-->5'direction, using energy provided by ATP hydrolysis; then it unwinds the four stranded DNA into single strands. This helicase activity may affect processes such as recombination and telomere extension, in which four stranded DNA could play a role.     

Divalent transition metal cations counteract potassium-induced quadruplex assembly of oligo(dG) sequences

Nucleic acids containing tracts of contiguous guanines tend to self-associate into four-stranded (quadruplex) structures, based on reciprocal non-Watson-Crick (G*G*G*G) hydrogen bonds. The quadruplex structure is induced/stabilized by monovalent cations, particularly potassium. Using circular dichroism, we have determined that the induction/stabilization of quadruplex structure by K+is specifically counteracted by low concentrations of Mn2+(4-10 mM), Co2+(0.3-2 mM) or Ni2+(0.3-0.8 mM). G-Tract-containing single strands are also capable of sequence-specific non-Watson-Crick interaction with d(G. C)-tract-containing (target) sequences within double-stranded DNA. The assembly of these G*G.C-based triple helical structures is supported by magnesium, but is potently inhibited by potassium due to sequestration of the G-tract single strand into quadruplex structure. We have used DNase I protection assays to demonstrate that competition between quadruplex self-association and triplex assembly is altered in the presence of Mn2+, Co2+or Ni2+. By specifically counteracting the induction/stabilization of quadruplex structure by potassium, these divalent transition metal cations allow triplex formation in the presence of K+and shift the position of equilibrium so that a very high proportion of triplex target sites are bound. Thus, variation of the cation environment can differentially promote the assembly of multistranded nucleic acid structural alternatives.     

Isolation and characterization of a monoclonal anti-quadruplex DNA antibody from autoimmune "viable motheaten" mice

A cell line that produces an autoantibody specific for DNA quadruplex structures has been isolated and cloned from a hybridoma library derived from 3-month-old nonimmunized autoimmune, immunodeficient "viable motheaten" mice. This antibody has been tested extensively in vitro and found to bind specifically to DNA quadruplex structures formed by two biologically relevant sequence motifs. Scatchard and nonlinear regression analyses using both one- and two-site models were used to derive association constants for the antibody-DNA binding reactions. In both cases, quadruplexes had higher association constants than triplex and duplex molecules. The anti-quadruplex antibody binds to the quadruplex formed by the promoter-region-derived oligonucleotide d(CGCG4GCG) (Ka = 3.3 x 10(6) M-1), and has enhanced affinity for telomere-derived quadruplexes formed by the oligonucleotides d(TG4) and d(T2G4T2G4T2G4T2G4) (Ka = 5.38 x 10(6) and 1.66 x 10(7) M-1, respectively). The antibody binds both types of quadruplexes but has preferential affinity for the parallel four-stranded structure. In vitro radioimmunofilter binding experiments demonstrated that purified anti-DNA quadruplex antibodies from anti-quadruplex antibody-producing tissue culture supernatants have at least 10-fold higher affinity for quadruplexes than for triplex and duplex DNA structures of similar base composition and length. The antibody binds intramolecular DNA triplexes formed by d(G4T3G4T3C4) and d(C4T3G4T3G4), and the duplex d(CGCGCGCGCG)2 with an affinities of 6. 76 x 10(5), 5.59 x 10(5), and 8.26 x 10(5) M-1, respectively. Competition experiments showed that melted quadruplexes are not effective competitors for antibody binding when compared to native structures, confirming that the quadruplex is bound structure-specifically. To our knowledge, this is the first immunological reagent known to specifically recognize quadruplex structures. Subsequent sequence analysis demonstrates homologies between the antibody complementarity determining regions and sequences from Myb family telomere binding proteins, which are hypothesized to control cell aging via telomeric DNA interactions. The presence of this antibody in the autoimmune repertoire suggests a possible linkage between autoimmunity, telomeric DNA binding proteins, and aging.     

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.     

Structural basis of DNA recognition and mechanism of quadruplex formation by the beta subunit of the Oxytricha telomere binding protein

Interactions of the beta subunit of the Oxytricha nova telomere binding protein with the telomeric DNA sequences, d(T4G4)2 and dT6(T4G4)2, have been investigated in vitro using Raman and fluorescence spectroscopies. Raman difference spectra show that the beta subunit binds to both d(T4G4)2 and dT6(T4G4)2 but promotes the formation of a parallel-stranded quadruplex only in dT6(T4G4)2, thus demonstrating the importance of the telomeric 5' tail for in vitro recognition and guanine quadruplex formation. While d(T4G4)2 is not a suitable substrate for quadruplex promotion by the beta subunit, the Raman spectra reveal other structural rearrangements of this DNA strand upon beta subunit binding, including changes in guanine glycosyl torsion angles from syn to anti and disruption of carbonyl hydrogen-bonding interactions. The conformation of d(T4G4)2 in the beta:d(T4G4)2 complex is suggested as a plausible intermediate along the pathway to formation of the parallel-stranded guanine quadruplex. Fluorescence band shifts indicate that at least one of the two tryptophans of the beta subunit is shielded from solvent as a consequence of DNA binding in both the beta:dT6(T4G4)2 and beta:d(T4G4)2 complexes. However, the Raman spectra of these complexes suggest no significant changes in the beta subunit secondary structure attendant with DNA binding. A model for beta subunit binding by Oxytricha telomeric DNA sequences and a mechanism for quadruplex formation are proposed. A key feature of this model is the use of a telomeric hairpin secondary structure as the recognition motif.     

Cytosine-cytosine+ base pairing stabilizes DNA quadruplexes and cytosine methylation greatly enhances the effect

Previous spectroscopic studies demonstrated that the oligodeoxynucleotide d(CGC G3 GCG) undergoes a reversible cation-dependent transition between Watson-Crick (WC) hairpin and parallel-stranded "G-DNA" quadruplex structures [Hardin, C.C., Watson, T., Corregan, M., & Bailey, C. (1992) Biochemistry 31, 833-841]. The relative stabilities of the structures were assessed as a function of pH, and it was found that the quadruplex was substantially stabilized (delta Tm = +15 degrees C) when the pH was shifted from 7.5 to 6 (apparent pKa = 6.8). In the present study, the effects of different cations and pH on four specific sequence varients were determined to test the proposal that this stabilization is due to C.C+ base pair formation mediated by N3-protonation of cytosine. Characteristically large differences in stability were observed when structures formed by d(TAT G3 ATA) and d(TAT G4 ATA) were thermally dissociated at pH 7 in the presence of different cations, verifying that Gn tracts bordered by TAT- and -ATA sequences form quadruplex structures. Imino proton NMR results indicate that the d(m5C G m5C G3 G m5C G)4 and d(TAT G4 ATA)4 quadruplex structures are parallel-stranded. It was necessary to increase the K+ concentration from 40 mM to ca. 200 mM to stabilize d(TAT G3 ATA)4, while the d(TAT G4 ATA)4 complex was nearly as stable as the quadruplex formed by d(CGC G3 GCG) under the same conditions. The d(TAT G4 ATA)4 quadruplex was only slightly stabilized at pH 6 relative to pH 7.5 (delta Tm = +3 degrees C), confirming that the unique stabilization that occurs in the pH 6.8 range with [d(CGC Gn GCG)4.ionn] complexes is due to the C residues. The sequence d(m5C G m5C G3 G m5C G) was found to form a very stable quadruplex in K+ or Ca2+. As with the quadruplex formed by the unmethylated analog, the stability is greatly enhanced when the pH is decreased below about 7.2 (pKa,obs = 6.8). Dissociation kinetic constants and activation energies were determined for quadruplexes formed by d(CGC G3 GCG), d(m5C G m5C G3 G m5C G) and d(TAT G4 ATA). Quantitative comparisons showed that methylation produces a complex that is much more stable at pH 7 in 40 mM Na+ than either of the unmodified structures; the rate-limiting activation energy for dissociation of d(CGC G3 GCG)4 was 22 kcal mol-1 less than for the methylated analog.(ABSTRACT TRUNCATED AT 400 WORDS)     

Intra- and interloop interactions in the folded G quartet structure of Oxytricha telomeric sequence

The antiparallel intramolecular G quartet structure for the 3.5 copy Oxytricha telomeric sequence d(G4T4)3G4 has been established using a combination of spectroscopic and chemical probing methods. In the presence of Na+ ions, this sequence exhibits a circular dichroism spectrum with a positive band at 295 nm and a negative band around 265 nm, characteristic of an antiparallel G quartet structure. Further, we show that d(G4T4)3G4 adopts an antiparallel intramolecular G quartet structure even in K+ unlike d(G4T4G4). KMnO4 probing experiments indicated the existence of intra and interloop interactions in the Na+ induced structure. We have found that K+ not only increases the thermal stability of G quartet structure but also binds to the loop region and disrupts stacking and interloop interactions. Biological consequences of such cation-dependent conformational micro-heterogeneity in the loop region of G quartet structures is also discussed.     

Spectroscopic investigation of an intramolecular DNA triplex containing both G.G:C and T.A:T triads and its complex with netropsin

The triple helix formation by the oligonucleotide 5'd(G4T4G4-[T4]-G4A4G4-[T4]-C4T4C4) ([T4] represents a stretch of 4 thymine residues) has been investigated by UV absorption spectroscopy and circular dichroism. In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we show the following significant results: i) In the absence of MgCl2, the oligonucleotide adopts a hairpin duplex structure with the dangling tail 5'd(G4T4G4-[T4]). This 5' extremity, which contains separated runs of four guanine residues, does not assume the expected tetraplex conformation observed when this sequence is free. ii) In the presence of MgCl2, the oligonucleotide folds back on itself twice to give a triple helix via a double hairpin formation, with [T4] single-strand loops. iii) The addition of high concentration of KCl to the preformed triplex does not disrupt the structure. Nevertheless, if the oligonucleotide is allowed to fold back in the presence of K+, triplex formation is inhibited. Circular dichroism studies demonstrate that the oligonucleotide adopts a dimeric conformation, resulting from the association of two hairpin duplexes, via the formation of an antiparallel G-quadruplex by the telomeric 5'd(G4T4G4-[T4]) extremities. iv) Under the experimental conditions used in this report, the triplex melts in a monophasic manner. v) Netropsin, a DNA minor groove ligand, binds to the central site A4/T4 of the duplex and to that of the triplex in an equimolar stoichiometry. In contrast with previous studies concerning pyr.pur:pyr triplexes, thermal denaturation experiments demonstrate that the netropsin binding stabilizes the intramolecular triplex.     

Hairpin-dimer equilibrium of a parallel-stranded DNA hairpin: formation of a four-stranded complex

The 24mer deoxyoligonucleotide 3'-d(T)10-5'-5'-d(C)4- d(A)10-3'(psC4) with an uncommon 5'-p-5'phosphodiester linkage was designed to enable the formation of a hairpin structure with unusual parallel-stranded stem. As reference hairpin structure with an antiparallel-stranded stem, the 24mer 5'-d(T)10-d(C)4-d(A)10-3'(apsC4) was chosen. The behaviour of these oligonucleotides at different temperatures, DNA and salt concentrations was characterised by a combination of UV melting, CD, CD melting, infrared and Raman spectroscopy, infrared melting and analytical ultracentrifugation. The parallel-stranded hairpin structure was found to be formed by psC4 only under conditions of low DNA concentration and low salt concentration. Increase of the NaCl concentration beyond the physiological level or high DNA concentration supports the formation of intermolecular multi-stranded structures. The experimental data are in agreement with a four-stranded complex formed by two molecules of psC4. The base pairing model of this asymmetric four-stranded complex is based on the pyrimidine motif of a triple helix with two bifurcated hydrogen bonds at the O4 of the thymine each directed towards one of the amino protons of both adenines. In contrast, the reference oligonucleotide apsC4 forms only an antiparallel-stranded hairpin under all experimental conditions.     

Effect of DNA secondary structure on human telomerase activity

Telomeres are specialized DNA-protein complexes located at the chromosome ends. The guanine-rich telomeric sequences have the ability to form G-quadruplex structures under physiological ionic conditions in vitro. Human telomeres are maintained through addition of TTAGGG repeats by the enzyme telomerase. To determine a correlation between DNA secondary structure and human telomerase, telomerase activity in the presence of various metal cations was monitored. Telomerase synthesized a larger proportion of products corresponding to four, five, eight, and nine full repeats of TTAGGG in 100 mM K+ and to a lesser extent in 100 mM Na+ when a d(TTAGGG)3 input primer was used. A more even product distribution was observed when the reaction mixture contained no added Na+ or K+. Increasing concentrations of Cs+ resulted in a loss of processivity but not in the distinct manner observed in K+. When the input primer contained 7-deaza-dG, the product distribution resembled that of reactions without K+ even in the presence of 100 mM K+. Native polyacrylamide gel electrophoresis indicated that d(TTAGGG)4, d(TTAGGG)5, d(TTAGGG)8, and d(TTAGGG)9 formed compact structures in the presence of K+. The oligonucleotide d(TTAGGG)4 had a UV spectrum characteristic of that of the G-quadruplex only in the presence of K+ and Na+. A reasonable explanation for these results is that four, five, eight, and nine repeats of TTAGGG form DNA secondary structures which promote dissociation of the primer from telomerase. This suggests that telomerase activity in cells can be modulated by the secondary structure of the DNA template. These findings are of probable relevance to the concept of telomerase as a therapeutic target for drug design.     

Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP

BACKGROUND: Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. RESULTS: The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. CONCLUSIONS: The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.     

A buried polar interaction can direct the relative orientation of helices in a coiled coil

Coiled coils consist of bundles of two or more alpha-helices that are aligned in a parallel or an antiparallel relative orientation. The designed peptides, Acid-p1 and Base-p1, associate in solution to form a parallel, heterodimeric two-stranded coiled coil [O'Shea, E. K., Lumb, K. J., and Kim, P. S. (1993) Curr. Biol. 3, 658]. The buried interface of this complex is formed by hydrophobic Leu residues, with the exception of an Asn residue from each strand that is positioned to engage in a buried polar interaction. Substitution of these buried Asn residues by Leu residues results in a loss of structural uniqueness, as evidenced by a lack of a particular helix orientation in the Acid-Base coiled-coil complex [Lumb, K. J., and Kim, P. S. (1995) Biochemistry 34, 8642]. Here, we alter the positions of the Asn residues in the Acid and Base peptides such that a buried polar interaction is only expected to occur when the helices are in an antiparallel orientation. The resulting peptides, Acid-a1 and Base-a1, associate to form a helical heterodimer, as shown by circular dichroism (CD) and equilibrium sedimentation centrifugation. The helix orientation preference has been measured using covalently linked, disulfide-containing heterodimers in which the constituent peptides are constrained to interact in either a parallel or an antiparallel orientation. Although both the parallel and antiparallel heterodimers form stable, helical structures, the antiparallel heterodimer is the predominant species at equilibrium when the heterodimers are allowed to undergo thiol-disulfide exchange. In addition, the antiparallel heterodimer is more stable to chemical denaturation than the parallel counterpart by approximately 2.3 kcal/mol. These results demonstrate that a single buried polar interaction in the interface between the helices of a coiled coil is sufficient to determine the relative orientation of its constituent helices.     

Formation of DNA triple helices incorporating blocks of G.GC and T.AT triplets using short acridine-linked oligonucleotides

We have used DNase I footprinting to assess triple helix formation at target sites containing the sequences A6G6.C6T6 and G6A6.T6C6. These sequences can be recognized by the acridine-linked oligopyrimidines Acr-T5C5 and Acr-C5T5 respectively at low pH, using well-characterised T.AT and C+.GC triplets. At pH 7.5 A6G6.C6T6 is specifically bound by Acr-G5T5, utilising G.GC and T.AT triplets in which the third strand runs antiparallel to the purine strand of the duplex. This interaction requires the presence of magnesium ions. No interaction was detected with Acr-T5G5, an oligonucleotide designed to form parallel G.GC and T.AT triplets. In contrast neither Acr-T5G5 nor Acr-G5T5 produced DNase I footprints with the target sequence G6A6.T6C6. These results suggest that, in an antiparallel R.RY triple helix, the T.AT triplet is weaker than the G.GC triplet. We find no evidence for the formation of structures containing parallel G.GC triplets.     

The crystal structure of zinc-containing ferredoxin from the thermoacidophilic archaeon Sulfolobus sp. strain 7

The crystal structure of ferredoxin from the thermoacidophilic archaeon Sulfolobus sp. strain 7 was determined by multiple isomorphous replacement supplemented with anomalous scattering effects of iron atoms in the Fe-S clusters, and refined at 2.0 A resolution to a crystallographic R value of 0.173. The structural model contains a polypeptide chain of 103 amino acid residues, 2 [3Fe-4S] clusters, and 31 water molecules; in this model, the cluster corresponding to cluster II in bacterial dicluster ferredoxins loses the fourth iron atom although it may originally be a [4Fe-4S] cluster. The structure of the archaeal ferredoxin consists of two parts: the core fold part (residues 37-103) and the N-terminal extension part (residues 1-36). The "core fold" part has an overall main-chain folding common to bacterial dicluster ferredoxins, containing two clusters as the active center, two alpha-helices near the clusters, and two sheets of two-stranded antiparallel beta-sheet (the terminal and central beta-sheets). The "N-terminal extension" part is mainly formed by a one-turn alpha-helix and a three-stranded antiparallel beta-sheet. The beta-sheet in the N-terminal extension is hydrogen-bonded with the terminal beta-sheet in the core fold to form a larger beta-sheet. The distinct structural feature of this archaeal ferredoxin lies in the zinc-binding center where the zinc ion is tetrahedrally ligated by four amino acid residues (His 16, His 19, and His 34 from the N-terminal extension, and Asp 76 from the core fold). The zinc ion in the zinc-binding center is located at the interface between the core fold and the N-terminal extension, and connects the beta-sheet in the N-terminal extension and the central beta-sheet in the core fold through the zinc ligation. Thus, the zinc ion plays an important role in stabilizing the structure of the present archaeal ferredoxin by connecting the N-terminal extension and the core fold, which may be common to thermoacidophilic archaeal ferredoxins.     

A novel DNA duplex. A parallel-stranded DNA helix with Hoogsteen base pairing

We show here for the first time that a stable parallel double helix with Hoogsteen pairing can exist independently of the triple helix of which it is a component part. The experiments employ DNA oligonucleotides with mixed sequences of normal bases. These duplexes are distinct from previously reported ribopolynucleotide helices containing bulky substituents which prevent Watson-Crick pairing as well as from parallel duplexes with Donohue, or reversed Watson-Crick, pairing. Stoichiometry is established by mixing curves and gel electrophoresis. Tm depends linearly upon pH, increasing with acidity because of the need to protonate N3 of C. The Tm of the 20-mer studied here is 52 degrees C at pH 5.2 and 0.1 M NaCl. At pH above 6, the molecule rearranges to form an antiparallel duplex with imperfect Watson-Crick pairing and loops, and the Tm is then independent of pH. The CD spectrum of the parallel duplex is very similar to that of the corresponding triple helix but quite different from that of the Watson-Crick helix. The infrared spectrum in the double bond region closely resembles that of the triple helix but, as with the CD, is quite different from that of the Watson-Crick duplex. The infrared spectra of the duplex and triple helix are also nearly identical in the region form 800 to 1000 cm-1, which is sensitive to backbone conformation. The only symmetry element present is a pseudorotational axis coincident with the helix axis of the parallel duplex as well as with the axis of the corresponding triple helix.(ABSTRACT TRUNCATED AT 250 WORDS)     

Sequence-specific binding protein of single-stranded and unimolecular quadruplex telomeric DNA from rat hepatocytes

A rat liver nuclear protein, unimolecular quadruplex telomere-binding protein 25, (uqTBP25) is described that binds tightly and specifically single-stranded and unimolecular tetraplex forms of the vertebrate telomeric DNA sequence 5'-d(TTAGGG)n-3'. A near homogeneous uqTBP25 was purified by ammonium sulfate precipitation, chromatographic separation from other DNA binding proteins, and three steps of column chromatography. SDS-polyacrylamide gel electrophoresis and Superdex copyright 200 gel filtration disclosed for uqTBP25 subunit and native Mr values of 25.4 +/- 0.5 and 25.0 kDa, respectively. Sequences of uqTBP25 tryptic peptides were closely homologous, but not identical, to heterogeneous nuclear ribonucleoprotein A1, heterogeneous nuclear ribonucleoprotein A2/B1, and single-stranded DNA-binding proteins UP1 and HDP-1. Complexes of uqTBP25 with single-stranded or unimolecular quadruplex 5'-d(TTAGGG)4-3', respectively, had dissociation constants, Kd, of 2.2 or 13.4 nM. Relative to d(TTAGGG)4, complexes with 5'-r(UUAGGG)4-3', blunt-ended duplex telomeric DNA, or quadruplex telomeric DNA had >10 to >250-fold higher Kd values. Single base alterations within the d(TTAGGG) repeat increased the Kd of complexes with uqTBP25 by 9-215-fold. Association with uqTBP25 protected d(TTAGGG)4 against nuclease digestion, suggesting a potential role for the protein in telomeric DNA transactions.     

Solution conformations and interactions of alpha and beta subunits of the Oxytricha nova telomere binding protein: investigation by Raman spectroscopy

Solution conformations of the alpha and beta subunits of the Oxytricha nova telomere binding protein have been investigated by Raman spectroscopy. Raman spectra have also been obtained for a deletion mutant of the beta subunit, betaC232, which retains the N-terminal domain that is active in ternary complex (alpha:beta:DNA) formation but lacks the C-terminal domain that is active in catalyzing guanine quadruplex formation. The Raman spectra show that alpha, beta, and betaC232 are rich in beta-strand secondary structure ( approximately 40-50%) and turns. The Raman signature of the C-terminal 153 amino acids of beta, generated by subtracting the spectrum of betaC232 (residues 1-232) from that of the full subunit, indicates that the domain active in guanine quadruplex formation contains less beta-strand secondary structure and more irregular structure than the domain active in alpha:beta:DNA formation. Raman markers also provide information about the environments and orientations of several key side chains, including tryptophan residues in N- and C-terminal domains of the beta subunit. Both alpha and beta denature between 30 and 40 degrees C, as evidenced by large changes in Raman bands diagnostic of main chain conformation and side chain environments. The Raman spectrum of an equimolar alpha/beta mixture exhibits no evidence of specific interaction between the subunits; further, the denaturation profile of this mixture is indistinguishable from the sum of denaturation profiles of the constituent subunits, consistent with the absence of appreciable interaction between alpha and beta throughout the range 0-50 degrees C. The present results provide insights into the solution conformations of the Oxytricha telomere binding protein subunits and serve as the basis for future study of subunit interactions with telomeric DNA.