共查询到20条相似文献,搜索用时 15 毫秒
1.
We show that archaebacterial DNA polymerases are strongly inhibited by the presence of small amounts of uracil-containing DNA. Inhibition appears to be competitive, with the DNA polymerase exhibiting approximately 6500-fold greater affinity for binding the inhibitor than a DNase I-activated DNA substrate. All six archaebacterial DNA polymerases tested were inhibited, while no eubacterial, eukaryotic, or bacteriophage enzymes showed this effect. Only a small inhibition resulted when uracil was present as the deoxynucleoside triphosphate, dUTP. The rate of DNA synthesis was reduced by approximately 40% when dUTP was used in place of dTTP for archaebacterial DNA polymerases. Furthermore, an incorporated dUMP served as a productive 3'-primer terminus for subsequent elongation. In contrast, the presence of an oligonucleotide containing as little as a single dUrd residue was extremely inhibitory to DNA polymerase activity on other primer-template DNA. 相似文献
2.
Three minor-groove binding ligands have been used to study the characteristics of two d(GA x CT)n DNAs embedded in longer DNA fragments. The binding of mithramycin, netropsin or Thia-Net to these sequences has been studied using DNAse I footprinting. None of these ligands appeared to bind to d(GA x CT)5 nor to d(GA x CT)22 extensively, although with mithramycin some protected bonds were detected at the very edge of these sequences. In general, these small ligands did not enhance the DNAse I cleavage patterns at the alternating d(GA x CT)n flanking sequences located near DNA regions where the drug was bound. The d(GA x CT)n sequences could act as a rigid block in which it is not easy to propagate structural changes, whereas other sequences flanking the binding sites showed cleavage enhancements. 相似文献
3.
T Hudson 《Canadian Metallurgical Quarterly》1997,71(5):20-2, 24, 26
As doctors jump at offers from practice managers, many ignore business basics. But even a good lawyer can't cover everything. "No matter how carefully you make an agreement with one company, if it is swallowed up by another, it can be very different than you anticipated," says a doctor who sold his Southern California network only to be fired after a change in owners. "You could go to bed with Albert Schweitzer and wake up with Attila the Hun." 相似文献
4.
Steroid binding domains of Na,K-ATPase and the nuclear hormone receptors share amino acid sequence homologies. In a ouabain radioligand assay, the potencies of series of planar or bent steroid moieties suggest that the domain in Na,K-ATPase can accommodate compounds with a planar configuration. The A/B -cis, C/D-cis steroid configuration in the cardenolides, in conjunction with appropriate substituents at the 3 and 17 positions, may represent a fortuitous "fit" for the exogenous compounds. It remains to be determined if the putative physiological digitalis-like substance is a member of a hormonal steroid family, an endogenous ouabain-like compound or both. 相似文献
5.
The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences. 相似文献
6.
Replies to comments by T. Silverman (see record 1999-11125-007), J. Rierdan (see record 1999-11125-008), and J. S. Shapiro (see record 1999-11125-009) regarding the original article by Kraut et al (see record 1998-10886-001) on the impact of Internet usage on social relations and depression. The authors respond to the concerns of the previous authors. In response to Silverman, they note that most online relationships formed by participants in their study resulted primarily in informational rather than emotional support, unlike the participants in Silverman's group. In response to Rierdan, the authors argue that the importance of results was not in the size of the effects, but in their direction; even small negative changes experienced by many people using the Internet can be significant. The authors also respond to Shapiro's methodological concerns and her alternative explanation of results. (PsycINFO Database Record (c) 2010 APA, all rights reserved) 相似文献
7.
I Hirao S Yoshinari S Yokoyama Y Endo AD Ellington 《Canadian Metallurgical Quarterly》1997,(37):283-284
Ribosome-inactivating proteins, such as ricin, pepocin and gypsophilin, catalyze the hydrolysis of a single N-glycosidic bond at a specific position in rRNAs. Aptamers targeting pepocin were selected from a random sequence RNA pool that spanned 30 positions. After 8 rounds, the anti-pepocin aptamers were sequenced and a conserved hairpin motif was identified. Interestingly, the selected motif is quite different from the toxin-binding domains of rRNAs. 相似文献
8.
9.
Many important matrix proteins involved in bone remodeling contain separate domains that orient the protein on hydroxyapatite and interact with target cell receptors, respectively. We have designed two synthetic peptides that mimic the dual activities of these large, complex proteins by binding to calcium phosphate minerals and by engaging integrin-dependent signaling pathways in osteoblasts. The addition of either PGRGDS from osteopontin or PDGEA from collagen type I to the HAP-binding domain of statherin (N15 domain) did not alter its alpha-helical structure or diminish its affinity for hydroxyapatite. Immobilized N15-PGRGDS bound MC3T3-E1 osteoblasts predominantly via the alpha v beta 3 integrin and induced focal adhesion kinase (FAK) phosphorylation at comparable levels to immobilized osteopontin. Immobilized N15-PDGEA bound MC3T3-E1 osteoblasts predominantly through the alpha 2 beta 1 integrin and induced similar levels of FAK phosphorylation. Although both peptides induced FAK phosphorylation with similar time courses, only the N15-PDGEA peptide induced ERK1/2 phosphorylation, showing that these peptides are also capable of engaging integrin-specific signaling pathways. This peptide system can be used to study adhesion-dependent control of signaling in the context of the relevant biomineral surface and may also be useful in biomaterial and tissue engineering applications. 相似文献
10.
WW domains are conserved protein motifs of 38-40 amino acids found in a broad spectrum of proteins. They mediate protein-protein interactions by binding proline-rich modules in ligands. A 10 amino acid proline-rich portion of the morphogenic protein, formin, is bound in vitro by both the WW domain of the formin-binding protein 11 (FBP11) and the SH3 domain of Abl. To explore whether the FBP11 WW domain and Abl SH3 domain bind to similar ligands, we screened a mouse limb bud expression library for putative ligands of the FBP11 WW domain. In so doing, we identified eight ligands (WBP3 through WBP10), each of which contains a proline-rich region or regions. Peptide sequence comparisons of the ligands revealed a conserved motif of 10 amino acids that acts as a modular sequence binding the FBP11 WW domain, but not the WW domain of the putative signal transducing factor, hYAP65. Interestingly, the consensus ligand for the FBP11 WW domain contains residues that are also required for binding by the Abl SH3 domain. These findings support the notion that the FBP11 WW domain and the Abl SH3 domain can compete for the same proline-rich ligands and suggest that at least two subclasses of WW domains exist, namely those that bind a PPLP motif, and those that bind a PPXY motif. 相似文献
11.
DG Winkler JC Johnson JA Cooper AB Vojtek 《Canadian Metallurgical Quarterly》1997,272(39):24402-24409
The oncoprotein Ras transforms cells by binding to one or more effector proteins. Effector proteins have been identified by their ability to bind to Ras in the GTP but not GDP form, and by their requirement for the Ras effector domain for binding. The best understood Ras effectors are serine/threonine kinases of the Raf family, but other candidate Ras effectors, including a Ral guanine nucleotide dissociation stimulator and phosphatidylinositol 3-kinase (PI3 kinase) have also been identified. To investigate the mechanism of binding of cRaf-1 to Ras, and to investigate the roles of other candidate Ras effectors in transformation, we have isolated and characterized mutants of activated Ras with decreased binding to cRaf-1 relative to other candidate effectors. Examination of these mutants indicates that surface-exposed residues of Ras outside the minimal effector domain interact differentially with cRaf-1 and other Ras-binding proteins, and that fibroblast transformation correlates with cRaf-1 binding and mitogen-activated protein (MAP) kinase activation. Furthermore, activation of PI3 kinase can occur in the absence of significant MAP kinase activation, suggesting that PI3 kinase activation is a primary effect of Ras. 相似文献
12.
Thrombin, a multifunctional serine protease, recognizes multiple macromolecular substrates and plays a key role in both procoagulant and anticoagulant functions. The substrate specificity of thrombin involves two electropositive surfaces, the fibrinogen-recognition and heparin-binding exosites. The SELEX process is a powerful combinatorial methodology for identifying high-affinity oligonucleotide ligands to any desired target. The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro. Previously described DNA ligands bind the fibrinogen-recognition exosite, while competition and photocrosslinking experiments indicate that the DNA ligand 60-18[29] binds the heparin-binding exosite. DNA 60-18[29] is a quadruplex/duplex with a 15-nucleotide "core" sequence that has striking similarity to previously described DNA ligands to thrombin, but binds with 20 to 50-fold higher affinity. The 15-nucleotide core sequence has eight highly conserved guanine residues and forms a G-quadruplex structure. A single nucleotide within the G-quadruplex structure can direct the DNA to a distinct epitope. Additional sequence information in the duplex regions of ligand 60-18[29] contribute to greater stability and affinity of binding to thrombin. A low-resolution model for the interaction of DNA 60-18[29] to human thrombin has been proposed. 相似文献
13.
14.
M Eddleston JC de La Torre JY Xu N Dorfman A Notkins S Zolla-Pazner MB Oldstone 《Canadian Metallurgical Quarterly》1993,9(10):939-944
Monoclonal antibodies that bound to HIV gp41 and cross-reacted with astrocytes were recovered from the blood of three patients infected with HIV-1. Mapping of the specificity of these monoclonal antibodies, using synthetic gp41 peptides, located their epitope to amino acids 644-663 and established their conformation dependence. Six other human monoclonal anti-HIV antibodies were found to bind to HIV gp41 or gp120 but not to reactive astrocytes in brain tissue. Sharing of linear or conformational protein determinants between disparate viral and host proteins is termed molecular mimicry. The consequences of such mimicry by anti-viral antibodies interacting with astrocytes may play a role in the dementia of AIDS patients since a major function of astrocytes is to maintain the appropriate milieu for neuronal function. The finding of such cross-reactive antibodies adds to the evidence for a possible autoimmune pathogenesis in some of the disease manifestations accompanying HIV infection. 相似文献
15.
H Mamitsuka 《Canadian Metallurgical Quarterly》1998,33(4):460-474
Cells in the lateral hypothalamus and in the arcuate nucleus play prominent roles in the central control of food intake; however, a neurochemical link connecting these potential components of a hypothalamic circuitry regulating energy metabolism remains to be established. In the present study, the topographical relationship between cells expressing mRNAs encoding melanin-concentrating hormone and the newly discovered neuropeptide family hypocretins/orexins was studied in the rat and mouse lateral hypothalamus by using double-labeling in situ hybridization. Cells expressing the two mRNAs formed completely distinct populations, with hypocretin/orexin cells located primarily perifornically and in the magnocellular lateral hypothalamic nucleus; melanin-concentrating hormone cells extended in a wider area both laterally and periventricularly and appeared to partly surround the hypocretin/orexin population. In the arcuate nucleus, cells expressing neuropeptide Y and agouti gene-related protein were studied by routine fluorescence and/or confocal microscopy immunohistochemistry. Double staining demonstrated that a large proportion of the neuropeptide Y-positive cell bodies in this nucleus also contained agouti gene-related protein-like immunoreactivity. Moreover, these two peptides also coexisted in nerve terminals surrounding and in close relationship to perikarya and processes of both hypocretin/orexin- and melanin-concentrating hormone-immunoreactive cells in the lateral hypothalamus, whereby the former appeared to receive a more dense innervation. These results thus provide evidence for an arcuate-lateral hypothalamic neuropeptide Y/agouti gene-related protein pathway. Furthermore, the results implicate hypocretin/orexin and melanin-concentrating hormone-expressing cells as downstream targets in neuropeptide Y-induced feeding. 相似文献
16.
M Kai T Todo M Wada H Ryo C Masutani H Kobayashi H Morioka E Ohtsuka F Hanaoka K Sakaguchi 《Canadian Metallurgical Quarterly》1998,1397(2):180-188
Airborne substances can stimulate both the olfactory and the trigeminal nerve in the nose, giving rise to odor and pungent (irritant) sensations, respectively. Nose, eye, and throat irritation constitute common adverse effects in indoor environments. We measured odor and nasal pungency thresholds for homologous aliphatic aldehydes (butanal through octanal) and carboxylic acids (formic, acetic, butanoic, hexanoic, and octanoic). Nasal pungency was measured in subjects lacking olfaction (i.e., anosmics) to avoid odor biases. Similar to other homologous series, odor and pungency thresholds declined (i.e., sensory potency increased) with increasing carbon chain length. A previously derived quantitative structure-activity relationship (QSAR) based on solvation energies predicted all nasal pungency thresholds, except for acetic acid, implying that a key step in the mechanism for threshold pungency involves transfer of the inhaled substance from the vapor phase to the receptive biological phase. In contrast, acetic acid - with a pungency threshold lower than predicted - is likely to produce threshold pungency through direct chemical reaction with the mucosa. Both in the series studied here and in those studied previously, we reach a member at longer chain-lengths beyond which pungency fades. The evidence suggests a biological cut-off, presumably based upon molecular size, across the various series. 相似文献
17.
R Torres BL Firestein H Dong J Staudinger EN Olson RL Huganir DS Bredt NW Gale GD Yancopoulos 《Canadian Metallurgical Quarterly》1998,21(6):1453-1463
Localizing cell surface receptors to specific subcellular positions can be critical for their proper functioning, as most notably demonstrated at neuronal synapses. PDZ proteins apparently play critical roles in such protein localizations. Receptor tyrosine kinases have not been previously shown to interact with PDZ proteins in vertebrates. We report that Eph receptors and their membrane-linked ligands all contain PDZ recognition motifs and can bind and be clustered by PDZ proteins. In addition, we find that Eph receptors and ligands colocalize with PDZ proteins at synapses. Thus, PDZ proteins may play critical roles in localizing vertebrate receptor tyrosine kinases and/or their ligands and may be particularly important for Eph function in guidance or patterning or at the synapse. 相似文献
18.
Recognition success varies with how information is encoded (e.g., level of processing) and with what is already known as a result of past learning (e.g., word frequency). This article presents the results of experiments showing that preexisting connections involving the associates of studied words facilitate their recognition regardless of whether the words are intentionally encoded or are incidentally encoded under semantic or nonsemantic conditions. Words are more likely to be recognized when they have either more resonant connections coming back to them from their associates or more connections among their associates. Such results occur even though attention is never drawn to these associates. Regression analyses showed that these connections affect recognition independently of frequency, so the present results add to the literature showing that prior lexical knowledge contributes to episodic recognition. In addition, equations that use free-association data to derive composite strength indices of resonance and connectivity were evaluated. Implications for theories of recognition are discussed. (PsycINFO Database Record (c) 2010 APA, all rights reserved) 相似文献
19.
The value of high affinity-specific reagents in immunology is exemplified by the use of mAbs. Recent in vitro selection methods suggested that oligonucleotides may provide a useful alternative, especially where Abs have been insufficient thus far. We used a systematic evolution of ligands by exponential enrichment (SELEX) procedure to derive high affinity oligonucleotide ligands (aptamers) recognizing CD4. These RNase-resistant aptamers bound with high affinity and specificity as demonstrated using BIAcore (Stevenage, U.K.) technology. They also bound native CD4 on rat lymphocytes and specifically interfered with labeling by high affinity mAbs. All aptamers recognized the same binding site in the CDR2-like region in domain 1 of CD4. The applicability of these aptamers for immunologic studies was clearly demonstrated by their ability to block a fully allogeneic MLR in a CD4-specific manner. The high affinity and stability of aptamers point to their value in the analysis and functional manipulation of the immune system. 相似文献
20.
Thompson Ross A.; Tinsley Barbara R.; Scalora Mario J.; Parke Ross D. 《Canadian Metallurgical Quarterly》1989,44(9):1217
In recent years, statutes granting grandparents legal standing to petition for legally enforcable visitation with their grandchildren—even over parental objection—have been passed in all 50 states. This psycholegal review critically examines the origins of and justifications for this important change in family law, some of the psychological assumptions underlying this policy (e.g., the role of grandparents in child development), problems in judicial determinations of whether visitation is in a child's best interest, and both intended and unintended consequences for family functioning arising from this policy. In the end, although efforts to ensure multigenerational supports for children are admirable in the abstract, there are some significant risks in using legal policies for achieving this goal. Directions for further contributions from social scientists, as well as future directions in the evolution of grandparent visitation policy, are outlined. (PsycINFO Database Record (c) 2010 APA, all rights reserved) 相似文献