Cloning and characterization of mycovirus double-stranded RNA from the plant pathogenic fungus, Fusarium solani f. sp. robiniae

A mycovirus (named FusoV) from the phytopathogenic fungus, Fusarium solani f. sp. robiniae SUF704, has two kinds of double-stranded (ds) RNA genomes, designated M1 and M2. The cDNAs were constructed from FusoV genomic dsRNAs. The sequences of M1 and M2 cDNAs comprised 1645 and 1445bp, respectively. Sequence analysis showed that each dsRNA had a single long open reading frame (ORF) on only one of the strands. M1 ORF encodes a 519-amino acid residue polypeptide with a predicted molecular mass of 60 kDa. RNA-dependent RNA polymerase-conserved motifs were identified in the predicted amino acid sequence, and the polymerase synthesized dsRNA in vitro. The M2 ORF encodes a polypeptide of 413 amino acid residues with a predicted molecular mass of 44 kDa. The predicted amino acid sequence contained the sequence corresponding to those found in the purified 44-kDa capsid protein of FusoV.     

Cloning and characterization of two immunophilin-like genes, ilpA and fkpA, on a single 3.9-kilobase fragment of Aeromonas hydrophila genomic DNA

Antiserum to Aeromonas hydrophila A6 cell envelopes was shown in a previous study (C. Y. F. Wong, G. Mayrhofer, M. W. Heuzenroeder, H. M. Atkinson, D. M. Quinn, and R. L. P. Flower, FEMS Immunol. Med. Microbiol. 15:233-241, 1996) to protect mice against lethal infection by this organism. In this study, colony blot analysis of an A. hydrophila genomic library using antiserum to A. hydrophila A6 cell envelopes revealed a cosmid clone expressing a 30-kDa protein which has not been described previously in aeromonads. The nucleotide sequence of a 3.9-kb fragment derived from this cosmid which expressed the 30-kDa protein revealed two potential open reading frames (ORFs) with homology to known immunophilin proteins. ORF1 encoded a 212-amino-acid protein (molecular mass, 22.4 kDa) with 56% identity to the immunophilin SlyD protein of Escherichia coli. ORF1 was subsequently designated ilpA (immunophilin-like protein). ORF3 encoded a potential gene product of 268 amino acids with a typical signal sequence and a predicted molecular size of 28.7 kDa. The inferred amino acid sequence showed 46% identity with the sequence of the FkpA protein of E. coli and 40% identity with the sequence of the macrophage infectivity potentiator (Mip) protein of Legionella pneumophila. ORF3 was designated fkpA (FK506 binding protein) by analogy with the E. coli FkpA protein. Expression of the FkpA protein was confirmed by Western blot (immunoblot) analysis, which detected a 30-kDa protein, with antiserum to the Mip protein of Legionella longbeachae and a specific antiserum to anA. hydrophila 30-kDa membrane protein. PCR and Southern analysis showed that a DNA sequence encoding FkpA was found in all 178 aeromonads of diverse origins tested. A nonpolar insertion mutation in the fkpA gene did not attenuate virulence in a suckling mouse model nor did it affect the expression of hemolysins or DNase. This suggests that either the fkpA gene is not essential in the virulence of A. hydrophila under these conditions or there are other genes in A. hydrophila coding for proteins with similar functions.     

Small abundant DNA binding proteins from the thermoacidophilic archaeon Sulfolobus shibatae constrain negative DNA supercoils

Major DNA binding proteins, designated Ssh7, were purified from the thermoacidophilic archaeon Sulfolobus shibatae. The Ssh7 proteins have an apparent molecular mass of 6.5 kDa and are similar to the 7-kDa DNA binding proteins from Sulfolobus acidocaldarius and Sulfolobus solfataricus in N-terminal amino acid sequence. The proteins constitute about 4.8% of the cellular protein. Upon binding to DNA, the Ssh7 proteins constrain negative supercoils. At the tested Ssh7/DNA mass ratios (0 to 1.65), one negative supercoil was taken up by approximately 20 Ssh7 molecules. Our results, together with the observation that the viral DNA isolated from S. shibatae is relaxed, suggest that regions of free DNA in the S. shibatae genome, if present, are highly positively supercoiled.     

Adenovirus type 2 coded single-stranded DNA binding protein: in vivo phosphorylation and modification

The adenovirus type 2-coded single-stranded DNA binding protein (DBP) was shown to be a phosphoprotein and to exist in at least two forms that differ in mobility by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After a 30-min pulse with [35S]methionine or 32PO4, 35S- or 32P-labeled DBP had a nominal molecular weight of 74,000 whereas after a 30-min label followed by a 20-h chase, 35S- and 32P-labeled DBP had a nominal molecular weight of 77,000. Both large and small forms of 35S- and 32P-labeled DBP bound to single-stranded DNA-cellulose columns and were eluted by 0.4 to 0.6 M NaCl; both forms also were immunoprecipitated by antiserum against adenovirus type 1-simian virus 40-induced tumor cells (this antiserum contains antibodies against DBP) and by monospecific antiserum against 95 to 99% purified DBP. With highly purified 32P-DBP labeled 7 to 10 h postinfection, it was shown that the 32P radioactivity was firmly associated with protein material (i.e., not contaminating nucleic acids or phospholipids) and had properties expected of a phosphoester of an amino acid; paper electrophoresis of acid hydrolysates of this preparation identified phosphoserine but not phosphothreonine. Phosphoserine but not phosphothreonine was also identified in acid hydrolysates of another preparation of 32P-DBP labeled for 30 min, chased for 20 h, and then immunoprecipitated by adenovirus type 1-simian virus 40 antiserum.     

Purification and characterization of cysteine proteinase from a baculovirus gene

To analyze the degradation of product proteins at the late stage of virus infection in the baculovirus expression system, a cysteine proteinase was purified from hemolymph of Bombyx mori infected with wild-type B. mori nuclear polyhedorosis virus (BmNPV). The purified cysteine proteinase preparation had two protein bands (major 35-kDa active protein and 28-kDa inactive protein) on SDS-PAGE. Based on the N-terminal amino acid sequences of them, it was found that both proteins originated in the cysteine proteinase gene of BmNPV. The purified cysteine proteinase had an optimum pH at 4.0, and also had activities at neutral pHs. When recombinant luciferase was used as a natural substrate, it was degraded rapidly by the cysteine proteinase at the physiological pH of hemolymph. These results suggest that the cysteine proteinase from a BmNPV gene participates in the degradation of foreign protein expressed by the baculovirus system.     

Cloning of the gene encoding the Actinobacillus actinomycetemcomitans serotype b OmpA-like outer membrane protein

The gene encoding an outer membrane protein A (OmpA)-like, heat-modifiable Omp of Actinobacillus actinomycetemcomitans ATCC 43718 (strain Y4, serotype b) was cloned by a PCR cloning procedure. DNA sequence analysis revealed that the gene encodes a protein of 346 amino acid residues with a molecular mass of 36.9 kDa. The protein expressed by the cloned gene reacted with a monoclonal antibody to the previously described 29-kDa Omp (Omp29) of strain Y4. This monoclonal antibody reacted specifically with Omp29 of A. actinomycetemcomitans (serotype b), but not with any Omp of Escherichia coli, including OmpA. This protein exhibited characteristic heat modifiability on sodium dodecyl sulfate-polyacrylamide gels, showing an apparent molecular mass of 29 kDa when unheated and a mass of 34 kDa when heated. The N-terminal amino acid sequence of the protein expressed in E. coli perfectly matched those deduced from the purified Omp29 of strain Y4. The deduced amino acid sequence of the gene coding for Omp29 from serotype b matched completely (except for valine at position 321) that of a recently reported omp34 gene described for A. actinomycetemcomitans serotype c (NCTC 9710). Because of the conserved nature of the gene within these serotypes, we designated the gene described herein from serotype b as omp34.     

Synthesis and function of Actinomyces naeslundii T14V type 1 fimbriae require the expression of additional fimbria-associated genes

The nucleotide sequence of the chromosomal DNA flanking the Actinomyces naeslundii (formerly A. viscosus) T14V type 1 fimbrial structural subunit gene (fimP) was determined. Six open reading frames (ORFs), in the order 5' ORF3, ORF2, ORF1,fimP, ORF4, ORF5, ORF6 3', were identified. ORF1 encoded a protein of 408 amino acid residues (Mr = 39,270) and had significant sequence homology with the A. naeslundii T14V type 1 and A. naeslundii WVU45 type 2 fimbrial structural subunits. An in-frame fusion of ORF1 to the malE gene of the expression vector, pMAL-c2, yielded a protein that was immunostained with antibodies raised against the maltose binding protein and A. naeslundii T14V whole bacteria. Digestion of the fusion protein with factor Xa released a protein (apparent molecular mass of 34 kDa) that was immunostained only with the antibody directed against A. naeslundii T14V whole bacterial cells. Integration plasmids carrying a kanamycin resistance gene (kan) that was used to substitute for ORF1 or for DNA fragments internal to the coding region of the other five ORFs were used to transform A. naeslundii T14V. Neither type 1 fimbriae nor the 65-kDa fimbrial structural subunit was detected in mutants obtained by allelic replacement of ORF1 or ORF2. Mutants obtained by allelic replacement of ORF3 or ORF4 expressed only the 65-kDa fimbrial structural subunit. These mutants did not bind, in vitro, to proline-rich proteins that serve as the receptors for Actinomyces type 1 fimbriae. In contrast, a mutant in which the integration plasmid DNA had been inserted at a site close to the carboxyl terminus of ORF6 expressed type 1 fimbriae and had adherence properties similar to those observed in the wild-type strain. These results demonstrate the existence of additional genes near fimP that are likely to be involved in the synthesis and function of cell surface fimbriae of A. naeslundii T14V.     

Banana bunchy top virus DNA-3 encodes the viral coat protein

Banana bunchy top virus (BBTV) has a multicomponent genome consisting of at least six circular single-stranded DNAs each with a single large open reading frame (ORF) in the virion sense. A protein of approximately 20 kDa has been associated with purified virions and is assumed to be the viral coat protein. The N-terminus of this protein was sequenced and compared to the predicted amino acid sequence of the large ORF of BBTV DNA-1 to 6. This comparison indicated that the ORF of BBTV DNA-3, which potentially encodes a protein of 19.3 kDa, was the coat protein gene of BBTV. The ORF sequence of BBTV DNA-3 was cloned into a prokaryotic expression vector, pMAL-c2, and the resulting maltose binding-BBTV coat protein fusion product was purified and used for the production of polyclonal antiserum in a rabbit. The resultant antiserum was able to detect the presence of BBTV in infected leaf tissue confirming that the large virion sense ORF of BBTV DNA-3 encodes the viral coat protein.     

Cloning, sequencing and expression of the acylneuraminate lyase gene from Clostridium perfringens A99

The acylneuraminate lyase gene from Clostridium perfringens A99 was cloned on a 3.3 kb HindIII DNA fragment identified by screening the chromosomal DNA of this species by hybridization with an oligonucleotide probe that had been deduced from the N-terminal amino acid sequence of the purified protein, and another probe directed against a region that is conserved in the acylneuraminate lyase gene of Escherichia coli and in the putative gene of Clostridium tertium. After cloning, three of the recombinant clones expressed lyase activity above the background of the endogenous enzyme of the E. coli host. The sequenced part of the cloned fragment contains the complete acylneuraminate lyase gene (ORF2) of 864 bp that encodes 288 amino acids with a calculated molecular weight of 32.3 kDa. The lyase structural gene follows a noncoding region with an inverted repeat and a ribosome binding site. Upstream from this regulatory region another open reading frame (ORF1) was detected. The 3'-terminus of the lyase structural gene is followed by a further ORF (ORF3). A high homology was found between the amino acid sequences of the sialate lyases from Clostridium perfringens and Haemophilus influenzae (75% identical amino acids) or Trichomonas vaginalis (69% identical amino acids), respectively, whereas the similarity to the gene from E. coli is low (38% identical amino acids). Based on our new sequence data, the 'large' sialidase gene and the lyase gene of C. perfringens are not arranged next to each other on the chromosome of this species.     

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.     

Purification and DNA-binding properties of the integrase protein Int encoded by Lactobacillus plantarum phage

The Lactobacillus plantarum temperate phage phi g1e (42,259 bp) encodes an integrase gene int linked to a phage attachment site attP (Kakikawa et al., 1997). To investigate phi g1e recombination, the integrase protein Int was overproduced in Escherichia coli under the T7 promoter, and purified. The Int protein had an apparent molecular mass of 42.0 kDa, corresponding well with that (45.5 kDa) predicted from the DNA sequence. Amino-acid sequencing revealed that the N-terminal 20 amino-acids of the purified Int protein completely coincided with those deduced from the DNA sequence, although deficient in the first methionine. Gel mobility-shift assays demonstrated that Int bound specifically to the attP region. In addition, footprinting analysis showed that Int protected about 35 bases, containing the 24-bp core domain at attP, from DNase I attack. These results are indicative of site-specific interaction of Int with the attP site, the reaction prerequisite for integration and excision of the phi g1e genome into and/or out of the host chromosome.     

Sequence-specific single-strand RNA binding protein encoded by the human LINE-1 retrotransposon

Previous experiments using human teratocarcinoma cells indicated that p40, the protein encoded by the first open reading frame (ORF) of the human LINE-1 (L1Hs) retrotransposon, occurs in a large cytoplasmic ribonucleoprotein complex in direct association with L1Hs RNA(s), the p40 RNP complex. We have now investigated the interaction between partially purified p40 and L1Hs RNA in vitro using an RNA binding assay dependent on co-immunoprecipitation of p40 and bound RNA. These experiments identified two p40 binding sites on the full-length sense strand L1Hs RNA. Both sites are in the second ORF of the 6000 nt RNA: site A between residues 1999 and 2039 and site B between residues 4839 and 4875. The two RNA segments share homologous regions. Experiments involving UV cross-linking followed by immunoprecipitation indicate that p40 in the in vitro complex is directly associated with L1Hs RNA, as it is in the p40 RNP complex found in teratocarcinoma cells. Binding and competition experiments demonstrate that p40 binds to single-stranded RNA containing a p40 binding site, but not to single-stranded or double-stranded DNA, double-stranded RNA or a DNA-RNA hybrid containing a binding site sequence. Thus, p40 appears to be a sequence-specific, single-strand RNA binding protein.     

Isolation of a gene encoding a developmentally regulated T cell-specific protein with a guanine nucleotide triphosphate-binding motif

In this study, we describe a novel full length cDNA clone designated Tgtp that encodes a predicted 415-amino acid a T cell-specific guanine nucleotide triphosphate-binding protein (TGTP) bearing the characteristic motifs of a guanine nucleotide triphosphate (GTP) binding protein. Tgtp is expressed preferentially, if not exclusively, in T cells, and is up-regulated in both unfractionated and in purified CD4+8+ thymocytes upon TCR cross-linking. In contrast, expression of Tgtp is peripheral T cells is maintained at relatively high levels and is not grossly affected by TCR cross-linking. Antiserum generated against synthetic peptides from the predicted TGTP amino acid sequence recognized a single protein with a molecular mass of approximately 50 kDa, corresponding well with the computed molecular mass of 47 kDa. The only known relative of Tgtp is MUSGTP, which is reportedly expressed in B cells and bears a GTP binding motif. Thus, the discovery of Tgtp resolves a subfamily of molecules with GTP binding motifs and apparent lymphoid lineage-restricted expression. Given the restricted expression pattern in T cells, the up-regulated expression observed in response to TCR signaling in immature thymocytes, and the presence of the motifs characteristic of GTP binding proteins, we suggest that TGTP may have an important function in T cell development and/or T cell activation.     

Replication protein A is the major single-stranded DNA binding protein detected in mammalian cell extracts by gel retardation assays and UV cross-linking of long and short single-stranded DNA molecules

Band shift and UV cross-linking assays were used to analyze the major single-stranded DNA (ssDNA) binding activity in lysates of primate and rodent cells. The ssDNA binding activity behaved chromatographically similar to that of replication protein A (RP-A), a multisubunit protein containing three polypeptides of molecular mass 70, 34, and 14 kDa. A 70-kDa protein was found to harbor the ssDNA binding activity when UV cross-linked to long ssDNA or to oligonucleotide probes. Monoclonal antibodies against the 70- and the 34-kDa subunits produced super-gel-shift patterns, demonstrating that the reactive protein is indeed RP-A and that the retarded native binding complex included both subunits. RP-A displayed oligonucleotide-specific binding dependent on oligomer length. Increasing oligonucleotide length led to the formation of slow migrating complexes harboring multiple RP-A molecules, suggesting that an interval of about 20-30 bases is required for the binding of RP-A molecules. While similar binding activity was detected in cell extracts derived from proliferating and quiescent cells, a sharp decline in ssDNA binding activity was observed in the SV40-transformed Chinese hamster cell line 631 following UV irradiation. The nature of this decrease in activity and its possible effect on DNA replication is discussed.     

The largest (70 kDa) product of the bacteriophage T4 DNA terminase gene 17 binds to single-stranded DNA segments and digests them towards junctions with double-stranded DNA

Bacteriophage terminases are oligomeric multifunctional proteins that bind to vegetative DNA, cut it and, together with portal proteins, translocate the DNA into preformed heads. Most terminases are encoded by two partially overlapping genes. In phage T4 they are genes 16 and 17. We have shown before that the larger of these, gene 17, can yield, in addition to a full-length 70 kDa product, several shorter peptides. At least two of these, gene product (gp) 17' and gp17", are initiated in the same reading frame as the 70 kDa gp17 from internal ribosome binding sites. Most of the shorter gp17 s contain predicted ATPase motifs, but only the largest (70 kDa) peptide has a predicted single-stranded DNA binding domain. Here we describe the DNA binding and cutting properties of the purified 70 kDa protein, expressed from two different clones containing gene 17 but no other T4 gene. Epitope-specific antibodies, which recognize several different gene 17 products in extracts of induced clones or of T4-infected cells, precipitate the purified 70 kDa gp17. When Mg2+ is chelated by EDTA this 70 kDa protein binds to single-stranded DNA, preferentially to junctions of single- and double-stranded DNA segments. It does not bind to blunt-ended double-stranded DNA. When Mg2+ is present the purified 70 kDa gp17 digests single-stranded segments preferentially up to junctions with double-stranded DNA. A 70 kDa gp17 from a P379L temperature sensitive (ts) mutant, which has lost the nuclease and ATPase activities, retains the single-stranded DNA binding activity. Taken together with earlier findings these results support a model for packaging of T4 DNA from single-stranded regions in recombinational or replicative intermediates, which occur at nearly random positions of the genome. This mechanism may be an alternative to site-specific initiation of packaging proposed by other investigators.     

Expression and regulation of protein inhibitor of neuronal nitric oxide synthase in ventilatory muscles

Rice tungro bacilliform virus (RTBV) is a plant pararetrovirus and a member of the Caulimoviridae family and closely related to viruses in the Badnavirus genus. The coat protein of RTBV is part of the large polyprotein encoded by open reading frame 3 (ORF3). ORF3 of an RTBV isolate from Malaysia was sequenced (accession no. AF076470) and compared with published sequences for the region that encodes the coat protein or proteins. Molecular mass of virion proteins was determined by mass spectrometry (matrix-assisted laser desorption/ionization-TOF) performed on purified virus particles from three RTBV isolates from Malaysia. The N- and C-terminal amino acid sequences of the coat protein were deduced from the mass spectral analysis, leading to the conclusion that purified virions contain a single coat protein of 37 kDa. The location of the coat protein domain in ORF3 was reinforced as a result of immunodetection reactions using antibodies raised against six different segments of ORF3 using Western immunoblots after SDS-PAGE and isoelectrofocusing of proteins purified from RTBV particles. These studies demonstrate that RTBV coat protein is released from the polyprotein as a single coat protein of 37 kDa.