Facklamia ignava sp. nov., isolated from human clinical specimens

Two strains of a hitherto-undescribed gram-positive, catalase-negative coccus isolated from human sources were characterized by phenotypic and molecular taxonomic methods. Comparative 16S rRNA gene sequencing studies demonstrated that the unknown strains are genealogically identical and constitute a new line close to, but distinct from, Facklamia hominis. The unknown bacterium was readily distinguished from F. hominis by biochemical tests and electrophoretic analysis of whole-cell proteins. On the basis of phylogenetic and phenotypic evidence, it is proposed that the unknown bacterium be classified as Facklamia ignava sp. nov. The type strain of Facklamia ignava is CCUG 37419.     

Evolutionary relationships among members of the genus Chlamydia based on 16S ribosomal DNA analysis

Nucleotide sequences from strains of the four species currently in the genus Chlamydia, C. pecorum, C. pneumoniae, C. psittaci, and C. trachomatis were investigated. In vitro-amplified RNA genes of the ribosomal small subunit from 30 strains of C. pneumoniae and C. pecorum were subjected to solid-phase DNA sequencing of both strands. The human isolates of C. pneumoniae differed in only one position in the 16S rRNA gene, indicating genetic homogeneity among these strains. Interestingly, horse isolate N16 of C. pneumoniae was found to be closely related to the human isolates of this species, with a 98.9% nucleotide similarity between their 16S rRNA sequences. The type strain and koala isolates of C. pecorum were also found to be very similar to each other, possessing two different 16S rRNA sequences with only one-nucleotide difference. Furthermore, the C. pecorum strains truncated the 16S rRNA molecule by one nucleotide compared to the molecules of the other chlamydial species. This truncation was found to result in loss of a unilaterally bulged nucleotide, an attribute present in all other eubacteria. The phylogenetic structure of the genus Chlamydia was determined by analysis of 16S rRNA sequences. All phylogenetic trees revealed a distinct line of descent of the family Chlamydiaceae built of two main clusters which we denote the C. pneumoniae cluster and the C. psittaci cluster. The clusters were verified by bootstrap analysis of the trees and signature nucleotide analysis. The former cluster contained the human isolates of C. pneumoniae and equine strain N16. The latter cluster consisted of C. psittaci, C. pecorum, and C. trachomatis. The members of the C. pneumoniae cluster showed tight clustering and strain N16 is likely to be a subspecies of C. pneumoniae since these strains also share some antigenic cross-reactivity and clustering of major outer membrane protein gene sequences. C. psittaci and strain N16 branched early out of the respective cluster, and interestingly, their inclusion bodies do not stain with iodine. Furthermore, they also share less reliable features like normal elementary body morphology and plasmid content. Therefore, the branching order presented here is very likely a true reflection of evolution, with strain N16 of the species C. pneumoniae and C. psittaci forming early branches of their respective cluster and with C. trachomatis being the more recently evolved species within the genus Chlamydia.     

Comparison of the 16S/23S ribosomal intergenic regions of "Candidatus Liberobacter asiaticum" and "Candidatus Liberobacter africanum," the two species associated with citrus huanglongbing (greening) disease

16S/23S intergenic spacer regions from the rRNA operons of two strains of "Candidatus Liberobacter asiaticum" and one strain of "Candidatus Liberobacter africanum" were cloned and sequenced. The intergenic spacers of the two "Candidatus L. asiaticum" strains studied are identical and contain the genes for isoleucine tRNA (tRNA(Ile)) and alanine tRNA (tRNA(Ala)) separated by 11 nucleotides. The intergenic spacer of the "Candidatus L. africanum" strain contains only one tRNA gene (tRNA(Ala)). The level of homology between the intergenic spacers of the two liberobacter species is 79.46%. Ribosomal operons with 16S/23S spacer regions other than those studied might be present in the two "Candidatus Liberobacter" species.     

Comparison of different DNA fingerprinting techniques for molecular typing of Bartonella henselae isolates

Seventeen isolates of Bartonella henselae from the region of Freiburg, Germany, obtained from blood cultures of domestic cats, were examined for their genetic heterogeneity. On the basis of different DNA fingerprinting methods, including pulsed-field gel electrophoresis (PFGE), enterobacterial repetitive intergenic consensus (ERIC)-PCR, repetitive extragenic palindromic (REP) PCR, and arbitrarily primed (AP)-PCR, three different variants were identified among the isolates (variants I to III). Variant I included 6 strains, variant II included 10 strains, and variant III included only one strain. By all methods used, the isolates could be clearly distinguished from the type strain, Houston-1, which was designated variant IV. A previously published type-specific amplification of 16S rDNA differentiated two types of the B. henselae isolates (16S rRNA types 1 and 2). The majority of the isolates (16 of 17), including all variants I and II, were 16S rRNA type 2. Only one isolate (variant III) and the Houston-1 strain (variant IV) comprised the 16S rRNA type 1. Comparison of the 16S rDNA sequences from one representative strain from each of the three variants (I to III) confirmed the results obtained by 16S rRNA type-specific PCR. The sequences from variant I and variant II were identical, whereas the sequence of variant III differed in three positions. All methods applied in this study allowed subtyping of the isolates. PFGE and ERIC-PCR provided the highest discriminatory potential for subtyping B. henselae strains, whereas AP-PCR with the M13 primer showed a very clear differentiation between the four variants. Our results suggest that the genetic heterogeneity of B. henselae strains is high. The methods applied were found useful for typing B. henselae isolates, providing tools for epidemiological and clinical follow-up studies.     

An evaluation of intergenic rRNA gene sequence length polymorphism analysis for the identification of Legionella species

There are currently more than 40 species of Legionella and the identification of most of these by standard methods is technically difficult. The aim of this study was to assess the suitability of a previously published PCR-based method of identifying Legionella spp. Intergenic 16S-23S rDNA spacer regions were amplified with primers complementary to conserved regions of the rRNA genes. Following electrophoretic separation of the products, data analyses were performed with the Taxotron software package. Computer-assisted analysis (with an empirically derived error tolerance of 3%) could differentiate only 26 of the 43 strains (representing 43 species), with the remaining 17 species clustering into four groups (group I, comprising 10 species; group II, three species; group III, two species and group IV, two species). Analysis of well-characterised 'non-type' strains of some Legionella spp. (e.g., from type culture collections) resulted in patterns distinct from the corresponding type strain in most cases. Furthermore, recent isolates (identified by conventional methods) were identified by this PCR method to the presumed correct species (or species group) in only a minority of cases. Well characterised strains and recent isolates of Legionella showed heterogeneity within many species. This intra-species variation severely limits the usefulness of the method for the identification of isolates. However, this property may be useful for epidemiological typing within such species.     

Identification of lactic acid bacteria from chili bo, a Malaysian food ingredient

Ninety-two strains of lactic acid bacteria (LAB) were isolated from a Malaysian food ingredient, chili bo, stored for up to 25 days at 28 degreesC with no benzoic acid (product A) or with 7,000 mg of benzoic acid kg-1 (product B). The strains were divided into eight groups by traditional phenotypic tests. A total of 43 strains were selected for comparison of their sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) whole-cell protein patterns with a SDS-PAGE database of LAB. Isolates from product A were identified as Lactobacillus plantarum, Lactobacillus fermentum, Lactobacillus farciminis, Pediococcus acidilactici, Enterococcus faecalis, and Weissella confusa. Five strains belonging to clusters which could not be allocated to existing species by SDS-PAGE were further identified by 16S rRNA sequence comparison. One strain was distantly related to the Lactobacillus casei/Pediococcus group. Two strains were related to Weissella at the genus or species level. Two other strains did not belong to any previously described 16S rRNA group of LAB and occupied an intermediate position between the L. casei/Pediococcus group and the Weissella group and species of Carnobacterium. The latter two strains belong to the cluster of LAB that predominated in product B. The incidence of new species and subspecies of LAB in chili bo indicate the high probability of isolation of new LAB from certain Southeast Asian foods. None of the isolates exhibited bacteriocin activity against L. plantarum ATCC 14917 and LMG 17682.     

Identification of atypical strains of Staphylococcus epidermidis by use of molecular tools

Four atypical coagulase-negative staphylococcal (CNS) isolates from clinical sources were compared with Staphylococcus epidermidis strains by ribotyping. The ribotypes of the four strains shared close rDNA restriction profiles with those of the S. epidermidis strains used. The DNA sequence encoding 16S rRNA demonstrated 99.9% homology with S. epidermidis. S1 nuclease experiments showed that these atypical strains formed a homogeneous genomic group. DNA-DNA homologies between the S. epidermidis type strain CCM 2124 and the four CNS isolates ranged from 70 to 89%. The guanine-plus-cytosine content of the deoxyribonucleic acid of the four strains ranged from 31 to 32 mol%.     

Strain characterization and classification of oxyphotobacteria in clone cultures on the basis of 16S rRNA sequences from the variable regions V6, V7, and V8

A major problem in development of a polyphasic taxonomy is that the identification of oxyphotobacterial strains (cyanobacteria and prochlorophytes) in culture collections may be incorrect. We have therefore developed a diagnostic system using the DNA sequence polymorphism in the 16S rRNA regions V6 to V8 for individual strain characterization and identification. PCR primers amplifying V6 to V8 from oxyphotobacteria in unialgal cultures were constructed. Direct solid-phase or cyclic sequencing was used to determine the sequences from the amplified DNA. This survey includes 10 strains of Nostoc/Anabaena/Aphanizomenon (Nostoc category), 5 strains of Microcystis (Microcystis category), and 4 strains of Planktothrix (Planktothrix category). Fifteen additional strains of cyanobacteria and two strains of prochlorophytes were included such that the major phyletic groups were represented. One of the strains, Phormidium sp. NIVA-CYA 203, contained an 11-nucleotide insertion with no homology to other known 16S rRNA sequences. Based on parsimony and neighbor-joining trees, the phyletic relationships of the strains were investigated. Thirteen major branches were found, with Pseudanabaena limnetica NIVA-CYA 276/6 as the most divergent strain. The strain categories Nostoc, Planktothrix, and Microcystis were all monophyletic. The sequence polymorphism within Nostoc was higher than that in Planktothrix and Microcystis. Based on the sequence and phyletic information, group-specific PCR primers for the categories Nostoc, Planktothrix, and Microcystis were constructed. For the strains included in this work, the amplifications were specific for the relevant groups. By combination of magnetic solid-phase DNA isolation and group-specific PCR amplifications, an accurate method for characterization, classification and identification of oxyphotobacterial clone cultures has been developed.     

The phylogeny of unicellular, extremely halotolerant cyanobacteria

We examined the morphology, physiology, and 16S rRNA gene sequences of three culture collection strains and of ten novel isolates of unicellular cyanobacteria from hypersaline environments. The strains were morphologically diverse, with average cell widths ranging from 2.8 to 10.3 micron. There were single-celled, colonial, and baeocyte-forming strains. However, morphological traits were markedly variable with culture conditions. In contrast, all strains displayed extreme halotolerance (growing close to optimally at above 12% salinity); all were obligately marine, euryhaline, and moderately thermophilic; and all shared a suite of chemotaxonomic markers including phycobilins, carotenoids, and mycosporine-like amino acids. 16S rRNA gene sequence analysis indicated that the strains were related to each other. Sequence similarity analysis placed the strains in a monophyletic cluster (which we named the Halothece cluster) apart from all cultured or uncultured, not extremely halotolerant cyanobacteria whose 16S rRNA gene sequences are available in public nucleotide sequence databases. This represents the first case in which a phylogenetically coherent group of cyanobacteria can be defined on the basis of physiology. The Halothece cluster contained two subclusters that may be divergent at the generic level, one encompassing 12 strains (spanning 5% 16S rRNA gene sequence divergence and named the Euhalothece subcluster), and a single deep-branching isolate. Phenotypic characterization of the isolates, including morphological, physiological, and chemotaxonomic traits, did not distinguish these subclusters and only weakly suggested the existence of two separate clades, one encompassing strains of small cell size (cell width < 5 m) and another one encompassing strains of larger cell size.     

A simple and inexpensive method for the identification of Staphylococcus epidermidis and Staphylococcus hominis

Eight hundred and ninety-two strains of Staphylococcus species were identified by means of desferrioxamine susceptibility and fermentation results of three carbohydrates, with the API Staph system (bioMérieux, France) as reference method. No identification could be obtained for 34 strains with API Staph. Of the remaining 858 strains, identical identification was obtained with 842 (98.1%). All 707 strains identified as Staphylococcus epidermidis or Staphylococcus hominis by the API Staph system were found to be desferrioxamine susceptible, and all but 5 (3.3%) of 151 strains identified as other staphylococcal species were found to be resistant, yielding an identification correlation of 99.4% for desferrioxamine. The five additional strains which were susceptible to desferrioxamine were identified as Staphylococcus capitis (2 strains), Staphylococcus lugdunensis (2 strains), and Staphylococcus warneri (1 strain) by API Staph, and as Staphylococcus epidermidis (1 strain), Staphylococcus hominis (3 strains), and one other staphylococcal species by the experimental system.     

Survival during exposure to the electrophilic reagent N-ethylmaleimide in Escherichia coli: role of KefB and KefC potassium channels

On the basis of DNA-DNA hybridization data, nine intestinal spirochete strains were grouped into five genospecies. Three of these genospecies were previously recognized Serpulina species, Serpulina hyodysenteriae (type strain, B78), Serpulina innocens (type strain, B256), and Serpulina pilosicoli (type strain, P43/6/78; previously "Anguillina coli"). The other two genospecies were found to be new Serpulina species, for which we propose the names Serpulina intermedia sp. nov. (with type strain PWS/A) and Serpulina murdochii sp. nov. (with type strain 56-150). S. intermedia and S. murdochii cells had a typical spirochete ultrastructure with 22 to 28 periplasmic flagella per cell. Various soluble sugars were growth substrates for S. intermedia and S. murdochii. During growth in basal heart infusion broth supplemented with fetal calf serum beneath an O2-N2 (1:99) atmosphere, cells of these new species consumed oxygen and glucose and produced H2, CO2, acetate, butyrate, and ethanol. The G + C content of the DNA of S. murdochii 56-150T was 27 mol%, and the G + C content of the DNA of S. intermedia PWS/AT was 25 mol%. In addition, a restriction fragment length polymorphism-PCR assay for the detection of intestinal spirochetes was developed. The assay was based on generation and restriction endonuclease analysis (with HinfI, TaqI, Sau3A, and MboII) of a 558-bp amplicon of ribosomal DNA (rDNA) encoding 16S rRNA. The PCR amplification was specific for Serpulina species and Brachyspira aalborgi. Four restriction digest patterns were found for the five Serpulina species. HinfI restriction differentiated S. murdochii and S. innocens from the other species. Sau3A and TaqI restrictions gave unique fragment patterns for S. murdochii and S. pilosicoli, respectively. S. hyodysenteriae and S. intermedia DNAs gave the same fragment pattern regardless of the enzyme tested. B. aalborgi was differentiated from the Serpulina species by MboII digestion of the 16S rDNA amplicon.     

Molecular evolution of Mycoplasma capricolum subsp. capripneumoniae strains, based on polymorphisms in the 16S rRNA genes

Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia were determined. Nucleotide differences which were present in only one of the two operons (polymorphisms) were detected in 24 positions. The polymorphisms were not randomly distributed in the 16S rRNA genes, and some of them were found in regions of low evolutionary variability. Interestingly, 11 polymorphisms were found in all the M. capricolum subsp. capripneumoniae strains, thus defining a putative ancestor. A sequence length difference between the 16S rRNA genes in a poly(A) region and 12 additional polymorphisms were found in only one or some of the strains. A phylogenetic tree was constructed by comparative analysis of the polymorphisms, and this tree revealed two distinct lines of descent. The nucleotide substitution rate of strains within line II was up to 50% higher than within line I. A tree was also constructed from individual operonal 16S rRNA sequences, and the sequences of the two operons were found to form two distinct clades. The topologies of both clades were strikingly similar, which supports the use of 16S rRNA sequence data from homologous operons for phylogenetic studies. The strain-specific polymorphism patterns of the 16S rRNA genes of M. capricolum subsp. capripneumoniae may be used as epidemiological markers for CCPP.     

Species-specific oligonucleotides for enumeration of Pseudomonas putida F1, Burkholderia sp. strain JS150, and Bacillus subtilis ATCC 7003 in biodegradation experiments

Species-specific sequences were identified within the V4 variable region of 16S rRNA of two bacterial species capable of aromatic hydrocarbon metabolism, Pseudomonas putida F1 and Burkholderia sp. strain JS150, and a third, Bacillus subtilis ATCC 7003, that can function as a secondary degrader. Fluorescent in situ hybridization (FISH) with species-specific oligonucleotides was used for direct counting of these species throughout a phenol biodegradation experiment in batch culture. Traditional differential plate counting methods could not be used due to the similar metabolism and interactions of the primary degraders and difficulties in selecting secondary degraders in mixed culture. In contrast, the FISH method provided reliable quantitative results without interference from those factors.     

Purpose and guidelines for toxicokinetic studies within the National Toxicology Program

Urogenital mycoplasmal infections could affect use of primates as models for reproductive system studies and could affect reproduction in captive primates, but could be useful as animal models of similar human infections. We conducted a pilot study to assess detection of urogenital mycoplasmal infections in primates by use of polymerase chain reaction (PCR). Healthy animals were anesthetized, and vaginal, cervical, or endometrial and urethral swab specimens were collected from females and males, respectively. Specimens were tested by PCR supplemented with dot blotting and nonradiolabeled oligonucleotide probing for 16S rRNA sequences conserved among mollicutes. Specimens with positive results were tested by species-specific PCRs with primers for 16S rRNA sequences of Ureaplasma urealyticum and Mycoplasma hominis and for adhesin gene sequences of Mycoplasma genitalium. Spiked duplicate reactions were included as internal controls for each reaction. Results for 232 specimens from 166 animals indicate that naturally acquired urogenital infections are readily detected and suggest that urogenital mycoplasmal infections are common in laboratory primates (48/166 [29%] overall). M. hominis and U. urealyticum appeared to be common among the studied primates overall and especially in chimpanzees. Mycoplasmas other than M. genitalium, M. hominis, and U. urealyticum appeared to be at least as common as these three, with specimens from 18 of 48 animals (38%) having positive "generic" PCR results, but no positive results in species-specific PCRs.     

Phylogenetic analysis of Acinetobacter strains based on the nucleotide sequences of gyrB genes and on the amino acid sequences of their products

Partial nucleotide sequences of the gyrB genes (DNA gyrase B subunit genes) of 15 Acinetobacter strains, including the type and reference strains of genomic species 1 to 12 (A. calcoaceticus [genomic species 1], A. baumannii [genomic species 2], Acinetobacter genomic species 3, A. haemolyticus [genomic species 4], A. junii [genomic species 5], Acinetobacter genomic species 6, A. johnsonii [genomic species 7], A. lwoffii [genomic species 8], Acinetobacter genomic species 9, Acinetobacter genomic species 10, Acinetobacter genomic species 11, and A. radioresistens [genomic species 12]), were determined by sequencing the PCR-amplified fragments of gyrB. The gyrB sequence homology among these Acinetobacter strains ranged from 69.6 to 99.7%. A phylogenetic analysis, using the gyrB sequences, indicates that genomic species 1, 2, and 3 formed one cluster (87.3 to 90.3% identity), while genomic species 8 and 9 formed another cluster (99.7% identity). These results are consistent with those of DNA-DNA hybridization and of biochemical systematics. On the other hand, the topology of the published phylogenetic tree based on the 16S rRNA sequences of the Acinetobacter strains was quite different from that of the gyrB-based tree. The numbers of substitution in the 16S rRNA gene sequences were not high enough to construct a reliable phylogenetic tree. The gyrB-based analysis indicates that the genus Acinetobacter is highly diverse and that a reclassification of this genus would be required.     

Identification of Vibrio proteolyticus with a differential medium and a specific probe

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.     

Occult osseous injuries after ankle sprains: incidence, location, pattern, and age

The 16S rRNA gene sequences were determined for type strains of 21 Bifidobacterium species. A phylogenetic tree was constructed using the determined sequences and sequences from DNA databases, which contain the sequences of 11 type strains of Bifidobacterium species and 11 strains of related genera. All species of the genus Bifidobacterium and Gardnerella vaginalis ATCC 14018 belonged to a cluster phylogenetically distinct from the other genera. The cluster was divided into two subclusters: subcluster 1 composed of most species of Bifidobacterium and G. vaginalis, and subcluster 2 consisting of two species, B. denticolens and B. inopinatum; both of which were isolated from human dental caries. In the genus Bifidobacterium, four groups of species are known to be moderately to highly related by DNA-DNA hybridization. The four groups of species exhibited more than 99% similarity among their 16S rDNA sequences within each group. These results indicated that species with around 99% or more similarity in their 16S rDNA sequences should be confirmed for species identities.