Sequence polymorphism of mitochondrial DNA control region in Japanese

Sequence polymorphisms of the mitochondrial DNA (mtDNA) control region, hypervariable regions I and II, from 100 unrelated Japanese were determined by PCR amplification and direct sequencing. Sequences of 404 nucleotides for hypervariable region I and 379 nucleotides for region II were obtained. Variable sites (85 and 45) were revealed in region I and region II, respectively, as compared to the reference sequence, and a total of 96 different genetic patterns from both regions I and II were determined. A point mutation heteroplasmy was observed at the ratio of approximately 50:50 from one individual at the sequence position 151 showing a nucleotide transition from C to T. The probability of identity was estimated as 2.3% for region I, 3.9% for region II, and 1.1% combined for both regions. These results suggest that sequence polymorphism of mtDNA control region would be very useful in forensic practice as a marker for individual identification.     

Multiple independent origins of mitochondrial gene order in birds

Mitochondrial genomes of all vertebrate animals analyzed to date have the same 37 genes, whose arrangement in the circular DNA molecule varies only in the relative position of a few genes. This relative conservation suggests that mitochondrial gene order characters have potential utility as phylogenetic markers for higher-level vertebrate taxa. We report discovery of a mitochondrial gene order that has had multiple independent originations within birds, based on sampling of 137 species representing 13 traditionally recognized orders. This provides evidence of parallel evolution in mitochondrial gene order for animals. Our results indicate operation of physical constraints on mitochondrial gene order changes and support models for gene order change based on replication error. Bird mitochondria have a displaced OL (origin of light-strand replication site) as do various other Reptilia taxa prone to gene order changes. Our findings point to the need for broad taxonomic sampling in using mitochondrial gene order for phylogenetic analyses. We found, however, that the alternative mitochondrial gene orders distinguish the two primary groups of songbirds (order Passeriformes), oscines and suboscines, in agreement with other molecular as well as morphological data sets. Thus, although mitochondrial gene order characters appear susceptible to some parallel evolution because of mechanistic constraints, they do hold promise for phylogenetic studies.     

Evolutionary dynamics of tandem repeats in the mitochondrial DNA control region of the minnow Cyprinella spiloptera

Length variation due to tandem repeats is now recognized as a common feature of animal mitochondrial DNA; however, the evolutionary dynamics of repeated sequences are not well understood. Using phylogenetic analysis, predictions of three models of repeat evolution were tested for arrays of 260-bp repeats in the cyprinid fish Cyprinella spiloptera. Variation at different nucleotide positions in individual repeats supported different models of repeat evolution. One set of characters included several nucleotide variants found in all copies from a limited number of individuals, while the other set included an 8-bp deletion found in a limited number of copies in all individuals. The deletion and an associated nucleotide change appear to be the result of a deterministic, rather than stochastic, mutation process. Parallel origins of repeat arrays in different mitochondrial lineages, possibly coupled with a homogenization mechanism, best explain the distribution of nucleotide variation.     

Polymorphic sites in human mitochondrial DNA control region sequences: population data and maternal inheritance

Short-circuit current (Isc), transepithelial conductance (Gt), electrical capacitance (CT) and the fluctuation in Isc were analyzed in polarized epithelial cells from the distal nephron of Xenopus laevis (A6 cell line). Tissues were incubated with Na+- and Cl--free solutions on the apical surface. Basolateral perfusate was NaCl-Ringer. Agents that increase cellular cAMP evoked increases in Gt, CT, Isc and generated a Lorentzian Isc-noise. The responses could be related to active, electrogenic secretion of Cl-. Arginine-vasotocin and oxytocin caused a typical peak-plateau response pattern. Stimulation with a membrane-permeant nonhydrolyzable cAMP analogue or forskolin showed stable increases in Gt with only moderate peaking of Isc. Phosphodiesterase inhibitors also stimulated Cl- secretion with peaking responses in Gt and Isc. All stimulants elicited a spontaneous Lorentzian noise, originating from the activated apical Cl- channel, with almost identical corner frequency (40-50 Hz). Repetitive challenge with the hormones led to a refractory behavior of all parameters. Activation of the cAMP route could overcome this refractoriness. All agents caused CT, a measure of apical membrane area, to increase in a manner roughly synchronous with Gt. These results suggest that activation of the cAMP-messenger route may, at least partly, involve exocytosis of a vesicular Cl- channel pool. Apical flufenamate depressed Cl- current and conductance and apparently generated blocker-noise. However, blocking kinetics extracted from noise experiments could not be reconciled with those obtained from current inhibition, suggesting the drug does not act as simple open-channel inhibitor.     

Evolutionary correlation between control region sequence and restriction polymorphisms in the mitochondrial genome of a large Senegalese Mandenka sample

We present here the first comparative analysis at the population level between Restriction Fragment Length Polymorphism (RFLP) and control region sequence polymorphism in a large and homogeneous Senegalese Mandenka sample. Eleven RFLP haplotypes and 60 different sequences are found in 119 individuals, revealing that a very high level of mtDNA diversity can be maintained in a small population. A sequence neighbor-joining tree and an analysis of molecular variance show that sequences associated with a given restriction haplotype are evolutionarily highly correlated: sequencing generally leads to the subtyping of RFLP haplotypes. Evolutionary relationships among RFLP haplotypes inferred from restriction site differences are in good agreement with those inferred from sequence data. A single difference is observed and is likely due to a single restriction homoplasy having occurred in the control region. Selective neutrality tests on both RFLP and sequence data accept the hypotheses of mtDNA neutrality and population equilibrium. The deep coalescence times (exceeding 50,000 yr) of sequences associated with the two most frequent restriction haplotypes confirm that the Niokolo Mandenka population has not passed through a recent bottleneck and that gene flow is maintained among West African populations despite ethnic differences.     

The contamination of birds with organic pollutants in the Lake Baikal region

Lake Baikal is considered to be the largest reservoir of fresh natural water in the world. Nevertheless industrial enterprises on its banks as well as river effluents contaminate this unique basin. In the present study birds' eggs (15 species) collected in the Baikal region (Selenga river estuary) have been analysed. Quantitative determination of more than 40 individual organic pollutants (polycyclic aromatic hydrocarbons, phenols, organochlorine compounds) has been carried out using GC-MS as an analytical tool. The results obtained demonstrated a wide range of toxicant concentrations (2-3 orders of magnitude) for various species. Very high levels of polycyclic aromatic hydrocarbons have been detected in the eggs of Anas platyrynchos (mallard), Tringa stagnatilis (marsh sandpiper) and Podiceps auritus (slavonian grebe). These particular species also have the highest levels of other toxicants. Taking into account high rate of metabolism of certain of these compounds in birds, it has been proposed that the major route of transfer into higher trophic levels is via water and aquatic invertebrates.     

Sequence from the assembly nucleation region of TMV RNA

In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.     

Evolution of the mitochondrial DNA control region in the mbuna (Cichlidae) species flock of Lake Malawi, East Africa

Considerable controversy has surrounded the application of mitochondrial DNA data to reconstruction of evolutionary relationships among the endemic cichlids of Lake Malawi. Central to this debate has been the issue of whether lineage sorting is complete, and thus whether these data actually reflect species phylogeny, or simply gene genealogy. Review of all mtDNA control region sequences available for members of one monophyletic subset of this species flock, the Malawi rockfishes, or mbuna, strongly indicates that lineage sorting is incomplete: Character-based analyses of these sequences reconstruct gene, not species, interrelationships. Analysis of the pattern of nucleotide substitutions differentiating these mtDNA alleles suggests that pyrimidine residues undergo transition substitutions more often than do purines. Estimation of the magnitude of derived sequence differentiation in light of the reconstructed gene genealogy suggests that the mbuna may be of considerably more recent vintage than previous molecular characterizations have indicated.     

Sequence and evolution of the Drosophila pseudoobscura glycerol-3-phosphate dehydrogenase locus

The Gpdh genomic region has been cloned and sequenced in Drosophila pseudoobscura. A total of 6.8 kb of sequence was obtained, encompassing all eight exons of the gene. The exons have been aligned with the sequence from D. melanogaster, and the rates of synonymous and nonsynonymous substitution have been compared to those of other genes sequenced in these two species. Gpdh has the lowest rate of nonsynonymous substitution yet seen in genes sequenced in both D. pseudoobscura and D. melanogaster. No insertion/deletion events were observed, and the overall architecture of the gene (i.e., intron sites, etc.) is conserved. An interesting amino acid reversal was noted between the D. melanogaster Fast allele and the D. pseudoobscura gene.     

Sequence analysis of the rat Brca1 homolog and its promoter region

OBJECTIVE: Isolated malleus-handle fracture is a clinical entity seldom reported in the medical literature but well known in the last century. The purpose of this paper was to review the literature over the last 150 years and describe three new cases. STUDY DESIGN: Extensive review of the literature and chart review of three patients with isolated malleus-handle fracture. SETTING: The study was performed partly at a private practice and partly in an academic tertiary referral center. PATIENTS: At least 43 malleus-handle fractures have been reported in the literature. Three new occurrences were studied. RESULTS: The review of the literature showed that head trauma with skull base fracture was the most frequent cause of malleus-handle fracture, followed by blows on the tympanic membrane and barotrauma, penetration of pen-holders or hair pins, penetration of twigs, and attempts to remove a foreign body pushed inside the ear. In the first patient reported here, the malleus-handle fracture was caused by a whirlpool bath, in the second, the cause was unknown, and, in the third, it was caused by a brisk decompression inside the ear canal. CONCLUSIONS: This lesion is not rare, and the diagnosis frequently is missed because the tympanic membrane appears intact. A careful otoscopic examination with pneumomassage, an abnormally high compliance at tympanometry, and a carefully recorded medical history may lead to the diagnosis of isolated malleus-handle fracture in a patient with a mild conductive hearing loss.     

The preprotein translocase of the mitochondrial inner membrane: function and evolution

Growing mitochondria acquire most of their proteins by the uptake of mitochondrial preproteins from the cytosol. To mediate this protein import, both mitochondrial membranes contain independent protein transport systems: the Tom machinery in the outer membrane and the Tim machinery in the inner membrane. Transport of proteins across the inner membrane and sorting to the different inner mitochondrial compartments is mediated by several protein complexes which have been identified in the past years. A complex containing the integral membrane proteins Tim17 and Tim23 constitutes the import channel for preproteins containing amino-terminal hydrophilic presequences. This complex is associated with Tim44 which serves as an adaptor protein for the binding of mtHsp70 to the membrane. mtHsp70, a 70 kDa heat shock protein of the mitochondrial matrix, drives the ATP-dependent import reaction of the processed preprotein after cleavage of the presequence. Preproteins containing internal targeting information are imported by a separate import machinery, which consists of the intermembrane-space proteins Tim9, Tim10, and Tim12, and the inner membrane proteins Tim22 and Tim54. The proteins Tim17, Tim22, and Tim23 have in common a similar topology in the membrane and a homologous amino acid sequence. Moreover, they show a sequence similarity to OEP16, a channel-forming amino acid transporter in the outer envelope of chloroplasts, and to LivH, a component of a prokaryotic amino acid permease, defining a new PRAT-family of preprotein and amino acid transporters.     

The fungal mitochondrial genome project: evolution of fungal mitochondrial genomes and their gene expression

The goal of the fungal mitochondrial genome project (FMGP) is to sequence complete mitochondrial genomes for a representative sample of the major fungal lineages; to analyze the genome structure, gene content, and conserved sequence elements of these sequences; and to study the evolution of gene expression in fungal mitochondria. By using our new sequence data for evolutionary studies, we were able to construct phylogenetic trees that provide further solid evidence that animals and fungi share a common ancestor to the exclusion of chlorophytes and protists. With a database comprising multiple mitochondrial gene sequences, the level of support for our mitochondrial phylogenies is unprecedented, in comparison to trees inferred with nuclear ribosomal RNA sequences. We also found several new molecular features in the mitochondrial genomes of lower fungi, including: (1) tRNA editing, which is the same type as that found in the mitochondria of the amoeboid protozoan Acanthamoeba castellanii; (2) two novel types of putative mobile DNA elements, one encoding a site-specific endonuclease that confers mobility on the element, and the other constituting a class of highly compact, structured elements; and (3) a large number of introns, which provide insights into intron origins and evolution. Here, we present an overview of these results, and discuss examples of the diversity of structures found in the fungal mitochondrial genome.     

The complete mitochondrial genome of Alligator mississippiensis and the separation between recent archosauria (birds and crocodiles)

The complete mitochondrial genome of the alligator, Alligator mississippiensis, was sequenced. The size of the molecule is 16,642 nucleotides. Previously reported rearrangements of tRNAs in crocodile mitochondrial genomes were confirmed and, relative to mammals, no other deviations of gene order were observed. The analysis of protein-coding genes of the alligator showed an evolutionary rate that is roughly the same as in mammals. Thus, the evolutionary rate in the alligator is faster than that in birds as well as that in cold-blooded vertebrates. This contradicts hypotheses of constant body temperatures or high metabolic rate being correlated with elevated molecular evolutionary rates. It is commonly acknowledged that birds are the closest living relatives to crocodiles. Birds and crocodiles represent the only archosaurian survivors of the mass extinction at the Cretaceous/Tertiary boundary. On the basis of mitochondrial protein-coding genes, the Haemothermia hypothesis, which defines birds and mammals as sister groups and thus challenges the traditional view, could be rejected. Maximum-likelihood branch length data of amino acid sequences suggest that the divergence between the avian and crocodilian lineages took place at approximately equal to 254 MYA.     

Rapid detection of sequence polymorphisms in the human mitochondrial DNA control region by polymerase chain reaction and single-strand conformation analysis in mutation detection enhancement gels

The article describes a rapid approach for the detection of sequence polymorphisms in the mitochondrial (mt)DNA control region that involves enzymatic amplification of each entire mtDNA control region (HV1 and HV2) and the subsequent analysis of the PCR products by single-strand conformation analysis (SSCA) in mutation detection enhancement (MDE) gels, followed by silver stain detection. HV1 and HV2 SSC reference ladders were developed to standardize the classification of the different mtDNA types. Twenty-five mtDNA types were observed among the 45 Spanish individuals analyzed: 11 types were observed in the HV1 region as compared with 10 types in the HV2 region. This mutation scanning strategy could be a promising method of potential use not only in forensic genetics but also in population and evolutionary studies.     

Abundant mitochondrial genome diversity, population differentiation and convergent evolution in pines

We examined mitochondrial DNA polymorphisms via the analysis of restriction fragment length polymorphisms in three closely related species of pines from western North America: knobcone (Pinus attenuata Lemm.), Monterey (P. radiata D. Don), and bishop (P. muricata D. Don). A total of 343 trees derived from 13 populations were analyzed using 13 homologous mitochondrial gene probes amplified from three species by polymerase chain reaction. Twenty-eight distinct mitochondrial DNA haplotypes were detected and no common haplotypes were found among the species. All three species showed limited variability within populations, but strong differentiation among populations. Based on haplotype frequencies, genetic diversity within populations (HS) averaged 0.22, and population differentiation (GST and theta) exceeded 0.78. Analysis of molecular variance also revealed that >90% of the variation resided among populations. For the purposes of genetic conservation and breeding programs, species and populations could be readily distinguished by unique haplotypes, often using the combination of only a few probes. Neighbor-joining phenograms, however, strongly disagreed with those based on allozymes, chloroplast DNA, and morphological traits. Thus, despite its diagnostic haplotypes, the genome appears to evolve via the rearrangement of multiple, convergent subgenomic domains.     

Using mitochondrial and nuclear DNA markers to reconstruct human evolution

Molecular genetic-data have greatly improved our ability to test hypotheses about human evolution. During the past decade, a large amount of nuclear and mitochondrial data have been collected from diverse human populations. Taken together, these data indicate that modern humans are a relatively young species. African populations show the largest amount of genetic diversity, and they are the most genetically divergent population. Modern human populations expanded in size first on the African continent. These findings support a recent African origin of modern humans, but this conclusion should be tempered by the possible effects of factors such as gene flow, population size differences, and natural selection.