Lack of correlation between the effects of transient exposure to glutamate and those of hypoxia/reoxygenation in immature neurons in vitro

To assess the influence of brain immaturity on the effects of oxygen deprivation and the participation of excitotoxicity, the consequences of a 6-h exposure to either hypoxia (95% N2/5% CO2) or 100 microM glutamate were studied in cultured fetal rat forebrain neurons taken at two maturational stages, i.e., 6 and 13 days in vitro. Cells were examined for their morphology, viability, energy metabolism reflected by 2-D-[3H]deoxyglucose uptake, and protein synthesis assessed by [3H]leucine incorporation. Apoptosis and necrosis were scored using the fluorescent dye 4,6-diamidino-2-phenylindole. Whereas 6-day-old neurons responded to a 6-h hypoxia by transient hypermetabolism, biphasic increase in protein synthesis, and cycloheximide-sensitive apoptotic death within 72 h postexposure, glutamate did not affect cell characteristics by the same time. In 13-day-old neurons, hypoxia induced both apoptosis (8.2%) and necrosis (22.3%). At this age, glutamate definitely reduced energy metabolism (26%) and protein synthesis (17%) by the end of exposure. The percentage of necrotic neurons reached 40.7%, but the rate of apoptosis was unchanged compared with controls. Therefore, excitotoxicity cannot account for hypoxia-induced injury in immature neurons, but its participation is suggested in older cells by the suppression of the necrotic component of hypoxia by glutamate receptor antagonists at 13 days.     

Stimulation of RNA and protein synthesis in isolated chondrocytes by human serum

The stimulation of isolated chicken embryo chondrocytes was studied by measuring the incorporation of [3H]uridine and [3H]leucine into cold trichloroacetic acid precipitable material after exposure of the chondrocytes to serum. The doseresponse relationships for the incorporation of uridine and leucine were similar to that of thymidine previously demonstrated. Exposure of the cells to serum-containing buffer for 15 min sufficed both for the stimulation of incorporation into the cells and for the depletion of 28% of the stimulating activity from the medium. Stimulation persisted for at least 17 h after removal of the serum. Studies where actinomycin D was added to inhibit RNA synthesis suggested that prior RNA synthesis was required for most of the stimulation of protein synthesis by serum factors.     

Enhanced cytotoxicity with interleukin-1 alpha and 5-fluorouracil in HCT116 colon cancer cells

Recombinant human interleukin-1 alpha (rIL-1 alpha), at concentrations that were not growth-inhibitory when given alone (100-10,000 U/ml), enhanced the growth inhibition resulting from a 72-h fluorouracil (FUra) exposure in HCT116 colon cancer cells. Median-effect analysis of clonogenic assays indicated that rIL-1 alpha, given 24 h prior to and following a 24-h exposure to FUra, increased lethality in a more than additive fashion. rIL-1 alpha did not appear to significantly affect [3H]-FUra metabolism, total [3H]-FUra-RNA incorporation or RNA retention after drug removal, inhibition of thymidylate synthase, or thymidine triphosphate pool depletion. During continuous exposure to rIL-1 alpha, transient stimulation of RNA and DNA synthesis was observed at 72 h, with a return to normal by 96 h. A 24-h exposure to 10 microM FUra altered the elution profile of newly synthesized DNA as monitored by pH step alkaline elution. An accumulation of lower-MW single-stranded DNA species was noted with FUra compared to control, accompanied by a significantly decreased proportion of DNA retained on the polycarbonate filter: 10% retained vs. 32% for control (P = 0.01). A 48-h exposure to rIL-1 alpha alone did not affect the elution profile of nascent DNA species, nor did it enhance the effects of FUra. Although FUra did not appreciably affect pulse [3H]-uridine incorporation into RNA for the initial 8-24 h of FUra exposure, progressive inhibition of net RNA synthesis was observed thereafter. FUra prevented the stimulatory effect of rIL-1 alpha on RNA synthesis, and net RNA synthesis was significantly inhibited (by 64-79% after 72 and 96 h) with the combination compared to rIL-1 alpha alone. Continuous exposure to 10 microM thymidine did not rescue cells from the lethality of FUra alone or the combination of FUra plus rIL-1 alpha, suggesting that depletion of deoxythymidine triphosphate as a consequence of thymidylate synthase inhibition was not the most important component of FUra toxicity. In contrast, 1 mM uridine provided partial protection against the toxicity of FUra alone or with rIL-1 alpha. Although uridine did not affect FUra metabolism, it decreased FUra-RNA incorporation by 42-60%, presumably as a consequence of the 2-fold expansion of UTP pools. [125I]-rIL-1 alpha binding was nonspecific; with a 24-h exposure, however, internalized [125I]-rIL-1 alpha exceeded cell surface-bound material by 2-fold.(ABSTRACT TRUNCATED AT 250 WORDS)     

Uptake of precursor and synthesis of transmitter in a histaminergic photoreceptor

As a first step in understanding how the supply of the neurotransmitter histamine is maintained in a photoreceptor, we followed the uptake and metabolism of the immediate precursor of histamine, histidine. [3H]Histidine taken up into photoreceptors and glia was detected using autoradiography, and synthesis of [3H]histamine from [3H]histidine was assayed with thin-layer chromatography. Photoreceptors from barnacles were pulsed (15 min) with [3H]histidine (0.2-200 microM), then maintained in normal saline for up to 24 hr. Autoradiography showed that photoreceptor somata, axons, and presynaptic arbors were labeled, but only weakly, like (nonhistaminergic) ganglion cells. Label instead was concentrated over surrounding glia. Stimulating preparations with light did not increase photoreceptor labeling. Grain counts from photoreceptor axons showed uptake of [3H]histidine into these neurons by a Na+-dependent mechanism with a Km of approximately 50 microM. Over 24 hr only 1% of the [3H]histidine taken up by preparations was converted to [3H]histamine either in the dark or in the light. Injections of [3H]histidine directly into photoreceptors established that synthesis takes place within the photoreceptors and confirmed that stimulation with light did not measurably affect the rate of conversion of [3H]histidine to [3H]histamine. These results suggest that de novo synthesis of transmitter is unlikely to be as important as its reuptake in maintaining neurotransmitter supply in these photoreceptor terminals. In support of this conclusion, photoreceptors accumulated more label when transmitter release was stimulated with high K+ and histamine uptake was antagonized with chlorpromazine.     

Regulation of opioid receptors in rat sensory neurons in culture

To determine whether opioid receptors in sensory neurons are regulated by chronic exposure to opioids, we assessed the binding of various opioid ligands to membranes derived from isolated rat dorsal root ganglia neurons grown in culture. Equilibrium binding of [3H]diprenorphine onto membranes from cells grown for 13-15 days revealed a saturable binding site with a Kd value of 0.3 +/- 0.2 nM and an approximate Bmax value of 1300 +/- 200 fmol/mg of protein. [3H]Diprenorphine binding increased 3-fold from 1-15 days in culture. The mu receptors represent approximately 70 +/- 11% of the [3H]diprenorphine binding sites, as indicated by saturation binding of [3H]DAMGO. The kappa and delta receptors represent approximately 10 +/- 3% and approximately 5 +/- 2% of the [3H]diprenorphine binding sites, respectively. Preexposure of neurons to 10 microM naloxone for 48 hr up-regulated the receptors by 40%, whereas incubation with 100 nM to 10 microM DAMGO for 48 hr resulted in a significant decrease in the Bmax value of opioid receptors, with a maximum reduction of 70%. The identification of a high level of opioid receptors expressed in isolated sensory neurons and their modulation by opioids demonstrates that cultured sensory neurons are an excellent model with which to study opioid receptor regulation.     

Effects of hormones on protein and amino acid metabolism in mammary-gland explants of mice

The effects of insulin, cortisol and prolactin on amino acid uptake and protein biosynthesis were determined in mammary-gland explants from mid-pregnant mice. Insulin stimulated [3H]leucine incorporation into protein within 15 min of adding insulin to the incubation medium. Insulin also had a rapid stimulatory effect on the rate of aminoiso[14C]butyric acid uptake, but it had no effect on the intracellular accumulation of [3H]leucine. Cortisol inhibited the rate of [3H]leucine incorporation into protein during the initial 4h of incubation, but it had no effect at subsequent times. [3H]Leucine uptake was unaffected by cortisol, but amino[14C]isobutyric acid uptake was inhibited after a 4h exposure period to this hormone. Prolactin stimulated the rate of [3H]leucine incorporation into protein when tissues were exposed to this hormone for 4h or more; up to 4h, however, no effect of prolactin was detected. At all times tested, prolactin had no effect on the uptake of either amino[14C]isobutyric acid or [3H]leucine. Incubation with actinomycin D abolished the prolactin stimulation of protein biosynthesis, but this antibiotic did not affect the insulin response. A distinct difference in the mechanism of action of these hormones on protein biosynthesis in the mammary gland is thus apparent.     

Studies of binding of testosterone-estradiol binding globulin for estradiol-17beta (author''s transl)

The in vitro incorporation of [3H]thymidine has been examined in thin slices of sheep skin. Most of the radioactivity (88%) was incorporated into the bulb cells of the wool follicles, and the technique is therefore suitable for the study of some aspects of wool follicle DNA synthesis. The effect of mimosine and a number of related 4(1H)-pyridones on [3H]thymidine incorporation into sheep skin slices was examined. Mimosine was shown to inhibit the incorporation at a concentration of 0-2 mM. At this concentration, the incorporation of [3H]uridine or [14C]leucine was not affected. The inhibition of [3H]thymidine incorporation was time dependent, 2 h of incubation being required for maximal inhibition of DNA synthesis, and was readily reversible by removal of mimosine from the incubation medium. The 3-hydroxyl-4-oxo function of the pyridone ring appears to be directly involved in DNA synthesis inhibition. The amino acid side chain is not a toxophoric centre, but changes in its polarity have been shown to affect the inhibitory activity. The results suggest that the primary action of mimosine on the inhibition of wool biosynthesis in vivo is the inhibition of follicle bulb cell DNA synthesis and consequently of cell division.     

Influence of different planes of energy supply prior to the breeding season on blood metabolites in female mink (Mustela vison)

To investigate biochemical events accounting for the outcome of central neurons following hypoxia/reoxygenation, cultured neurons from fetal rat forebrain were exposed to hypoxia (95% N2/5% CO2) for 6 h, and then reoxygenated for up to 96 h. Time-dependent changes in macromolecular biosynthesis were analysed by incorporation of [3H]uridine and [3H]leucine and were coupled to cell viability and lactate dehydrogenase leakage. Morphological features of necrosis and apoptosis were scored following nuclear incorporation of the fluorescent dye 4,6-diamidino-2-phenylindole. Hypoxia led to a 36% reduction of cell viability at the end of the reoxygenation period, while 23% of the neurons exhibited apoptosis. A biphasic increase in the rates of protein synthesis was measured 1 h after the onset of hypoxia (77% above controls) and by 48-h postreoxygenation (72%). The presence of cycloheximide during hypoxia inhibited both peaks of synthesis and prevented the development of apoptosis. Protein electrophoresis outlined specific alterations in constitutive proteins, and immunohistochemistry revealed an overexpression of the pro-apoptotic gene products Bax and ICE. Therefore, hypoxia followed by reoxygenation would trigger sequential changes in synthesis of specific proteins, leading to delayed and mainly apoptotic neuronal death.     

Nitric oxide involvement in regulating the dopamine transport in the striatal region of rat brain

Spontaneous [3H]dopamine ([3H]DA) overflow was measured from striatal slices in the presence of different glutamate (Glu) receptor agonists such as N-methyl-D-aspartate (NMDA), kainate (KA) and quisqualate (QA) and their corresponding antagonists, Dizocilpine maleate (MK-801), D-gamma-glutamyl-aminomethanesulfonic acid (GAMS) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), respectively. [3H]DA uptake and release in the presence of L-Arginine (L-Arg) and NG-nitro-arginine (L-N-Arg), an inhibitor of nitric oxide (NO) synthesis were also evaluated. L-N-Arg alone or combined with L-Arg significantly reduced [3H]DA uptake at 10 and 100 microM from 33% to 44% from striatal slices. Whereas, in brain synaptosomal fractions L-Arg induced a biphasic effect on that [3H]DA uptake in a dose dependent manner, and L-N-Arg showed an absolute inhibition in 80-90% of this [3H]DA uptake at 1-500 microM. The amino acids, lysine, valine and histidine (100 microM) had a little effect inhibitory on [3H]DA uptake from synaptosomal fractions. Glu agonists, NMDA (10 microM) and KA (10 microM) importantly increased the spontaneous [3H]DA overflow, which was blocked by MK-801 (10 microM) and GAMS (10 microM), respectively. QA had no effect on [3H]DA release. L-Arg (10-200 microM) potentiated the spontaneous [3H]DA overflow in a dose dependent fashion from striatal slices, being reverted by 10 microM L-N-Arg alone or in combination with all other compounds; whereas, lysine, histidine and valine did not modify that spontaneous [3H]DA overflow. Results support the hypothesis related to the participation of NO on DA transport possibly synthesized at the dopaminergic (DAergic) terminals in the striatum; also that L-Arg concentration may determine alternative mechanisms to regulate the DAergic activity at the striatum.     

Studies on the mechanism of action of potassium iodide on thyroid protein biosynthesis

Potassium iodide (KI) has been shown to have an antigoitrogenic action and to inhibit in vivo thyroid protein biosynthesis. Beef thyroid slices were used to clarify further the mechanism of action of KI. Incubations were performed in Krebs-Ringer-bicarbonate (KRB) buffer under 95%O2 and 5% CO2. KI caused a slight decrease in the uptake of [3H]eucine by the tissue. When labelled leucine incorporation into protein was measured it was found that 10(-6) M KI caused a marked inhibition. Increasing concentrations of KI up to 10(-3) M did not further increase this inhibition. This effect of KI was reduced by simultaneous addition of 0.5 mM KClO4 or 1 mM methylmercaptoimidazole (MMI). In several experiments it was found that equimolar amounts of thyroxine (T4) or triiodothyronine (T3) were more potent than KI in inhibiting thyroid protein biosynthesis. In double plabelled studies KI decreased [3H]leucine incorporation into thyroid soluble proteins and into immunoprecipitable thyroglobulin (T4) while it did not modify that of [14C]galactosamine. When tissue specificity was examined, KI failed to alter [3H]leucine incorporation into proteins either in the liver or in the submaxillary gland. The present results indicate that intracellular KI is necessary to exert its effect on protein synthesis, and that this effect is mediated through a organic form of iodine, probably iodothyronines. This action of KI is specific for the thyroid gland.     

A1 adenosine receptors modulate respiratory activity of the neonatal mouse via the cAMP-mediated signaling pathway

The effects of adenosine and its analogs on the function of the respiratory center were studied in the spontaneously active rhythmic slice of neonatal and juvenile mice (4-14 days old). Whole cell, spontaneous postsynaptic currents (sPSCs) and single channel KATP currents were recorded in inspiratory neurons of the pre-B?tzinger complex. Adenosine (50-600 microM) inhibited the respiratory rhythm. This was accompanied by increase in the activity of KATP channels in cell-attached patches. The A1 adenosine receptor agonist, 2-chloro-N6-cyclopentyladenosine (CCPA, 0.3-2 microM), inhibited the respiratory rhythm, sPSCs, and enhanced activity of KATP channels. The A1 adenosine receptor antagonist, 8-cyclopentyl-1, 3-dipropylxanthine (DPCPX, 1-3 microM), showed opposite effects and occluded the CCPA actions. Agents specific for A2 adenosine receptors (CGS 21860 and NECA, both applied at 1-10 microM) were without effect. Elevation of intracellular cAMP concentration ([cAMP]i) by 8-Br-cAMP (200-500 microM), forskolin (0.5-2 microM), or isobutylmethylxantine (IBMX, 30-90 microM) reinforced the rhythm, whereas NaF (100-800 microM) depressed it. The open probability of single KATP channels in cell-attached patches decreased after application of forskolin and increased in the presence of NaF. [cAMP]i elevation reversed the effects of A1 receptors both on the respiratory rhythm and KATP channels. A1 receptors and [cAMP]i modified the hypoxic respiratory response. In the presence of A1 agonists the duration of hypoxic augmentation shortened, and depression of the respiratory rhythm occurred earlier. Elevation of [cAMP]i prolonged augmentation and delayed the development of the depression. We conclude that A1 adenosine receptors modulate the respiratory rhythm via inhibition of intracellular cAMP production and concomitant activation of KATP channels.     

Adenosine A1 receptor-mediated inhibition of evoked glutamate release is coupled to calcium influx decrease in goldfish brain synaptosomes

Binding of [3H]cyclohexyladenosine (CHA) to the cellular fractions and P2 subfractions of the goldfish brain was studied. The A1 receptor density was predominantly in synaptosomal membranes. In goldfish brain synaptosomes (P2), 30 mM K+ stimulated glutamate, taurine and GABA release in a Ca(2+)-dependent fashion, whereas the aspartate release was Ca(2+)-independent. Adenosine, R-phenylisopropyladenosine (R-PIA) and CHA (100 microM) inhibited K(+)-stimulated glutamate release (31%, 34% and 45%, respectively). All of these effects were reversed by the selective adenosine A1 receptor antagonist, 8-cyclopentyltheophylline (CPT). In the same synaptosomal preparation, K+ (30 mM) stimulated Ca2+ influx (46.8 +/- 6.8%) and this increase was completely abolished by pretreatment with 100 nM omega-conotoxin. Pretreatment with 100 microM R-PIA or 100 microM CHA, reduced the evoked increase of intra-synaptosomal Ca2+ concentration, respectively by 37.7 +/- 4.3% and 39.7 +/- 9.0%. A possible correlation between presynaptic A1 receptor inhibition of glutamate release and inhibition of calcium influx is discussed.     

Site-directed mutagenesis of the human A1 adenosine receptor: influences of acidic and hydroxy residues in the first four transmembrane domains on ligand binding

To provide new insights into ligand/A1 adenosine receptor (A1 AR) interactions, site-directed mutagenesis was used to test the role of several residues in the first four transmembrane (TM) domains of the human A1 AR. Based on multiple sequence analysis of all known ARs, both acidic (glutamic acid and aspartic acid) and polar hydroxy (serine and threonine) amino acids were identified that could potentially play a role in binding adenosine. Glu16 (TM1), Asp55 (TM2), Ser93 and Ser94 (TM3), Ser135 (TM4), and Thr 141 (TM4) were identified in all ARs, and Ser6 and Ser23 (TM1) were identified in all A1 ARs. To test the role of these residues, each was individually mutated to alanine. When Ala6, Ala23, Ala50, Ala93, Ala135, and Ala141 constructs were tested, affinities for [3H]2-chloro-N6-cyclopentyladenosine (CCPA) and [3H]1,3-dipropyl-8-cyclopentylxanthine (DPCPX) were similar to those seen for the wild-type receptor. After conversion of Glu16 to Ala16, the affinity for [3H]CCPA and other agonists fell 10-100-fold, whereas the affinity for [3H]DPCPX and other antagonists was not affected. After conversion of Asp55 to Ala55, the affinity for [3H]CCPA and other agonists increased < or = 100-fold, whereas the affinity for [3H]DPCPX and other antagonists was not affected. Studies of the Ala55 construct also revealed that Asp55 is responsible for allosteric regulation of binding by sodium because the affinity for [3H]CCPA did not change over broad ranges of sodium concentrations. When Ser94 was converted to Ala94, A1 AR immunoreactivity was present on stable cell lines; however, functional binding sites could not be detected. When Ser94 was converted to Thr94, the affinity for some xanthine antagonists fell. These data show that Glu16 in TM1 and Asp55 in TM2 play important roles in agonist/A1 AR interactions and show that Asp55 is responsible for allosteric regulation of ligand/A1 AR binding by sodium. We also identify Ser94 as an important site for ligand binding.     

Upregulation of Na(+)-dependent alanine transport in vascular endothelial cells by serum: role of intracellular Ca2+

OBJECTIVE: Amino acid transport and its regulation in vascular endothelial cells remains a largely unexplored area. In this study, we evaluated alanine transport in bovine aortic endothelial cells to assess possible mechanisms of regulation. METHODS: Alanine transport into confluent monolayers of endothelial cells was measured using 100 microM [3H]alanine in the presence and absence of external Na+, in cells deprived of serum for 24 hr (SD), and in SD cells exposed to 10% serum (S) for 3 hr (SD + S cells). RESULTS: Our results indicate that although SD did not significantly affect the Na(+)-independent transport of alanine when compared to normal cells, serum addition to serum-deprived cells markedly stimulated the Na(+)-dependent uptake of this amino acid through system A. The stimulation of alanine transport pathway(s) by serum was totally abolished by pretreatment of endothelial cells with 10 microM cycloheximide, suggesting a role of protein synthesis. Serum also induced a marked increase in calcium recycling at the cell membrane, suggesting that calcium is a key element of the serum signaling pathway. Indeed, both BAPTA (20 microM), a cellular calcium chelator, and thapsigargin (1 microM), an agent that depletes intracellular calcium stores, prevented the stimulation of alanine uptake by serum. Finally, pertussis toxin (400 ng/ml), an agent known to inactivate certain G-protein-dependent pathways, significantly reduced the serum-dependent 45Ca uptake and [3H]alanine entry. However, the protein kinase C activator PMA (100 nM), significantly reduced the stimulation of alanine uptake by serum but did not affect the stimulation of calcium uptake. CONCLUSIONS: Altogether these findings suggest that cell calcium is involved in the regulation of system A by serum in vascular endothelial cells.     

Space deformation as a separation mechanism of DNA double helix strands

Cortex cells of the root meristem of Cucurbita pepo (0.0-0.5 mm from the cap junction), in the 3-4, 5-6 and 7-8 mm segments above the root tip, and the cells of the first three layers of lateral part of root cap were the object of the present study. The volume of cortex cells increases more than 20 times in the 7-8 mm segment as compared with meristematic cells, and the volume of cytoplasm about sevenfold. The largest increment of the cytoplasmic volume occurs between 0.5-6.0 mm. In consecutive root segments the sustained increase of the volume of nuclei takes place. By applying autoradiography the following processess have been investigated: DNA synthesis (3H thymidine uptake), template activity of DNA (3H actinomycin D(3H AMD)-binding), RNA synthesis (3H uridine incorporation), and protein synthesis (3H leucine). In the root cap cells and in segments where meristematic activity is over, DNA is replicated by endomitosis. On the basis of nuclear labelling it appears that nuclei in the 3-4 mm segment reach 4C ploidy state, but in the 7-8 mm segment half of the nuclei reach the 8C ploidy state. Most of the root cap cells are 4C, the remaining cells are 8C. Considering the uptake of 3H thymidine into nucleoli one may suppose that in the root cap cells nucleolar DNA is underreplicated, and to a lesser degree in 5-6 and 7-8 mm segments, while in 3-4 mm segment DNA is overreplicated as compared to meristem cells. Measurements of nucleolar volume, 3H uridine uptake, 3H AMD binding and quantity of granular component, indicate that the most noticeable nucleolar activity takes place in meristematic zone and in root parts showing the highest increase of cytoplasmic volume (3-4 and 5-6 mm segments). 3H leucine is still incorporated intensely into 7-8 mm segment, in which the concentration of ribosomes is low, however they are present in the form of polysomes. Comparison of 3H thymidine uptake into nuclear DNA with 3H AMD binding and 3H uridine incorporation into nuclei indicates that endomitotic DNA replication results in an increase of DNA template activity in root cap cells as well as in 3-4 and 5-6 mm segments; in the 7-8 mm segment binding of 3H AMD slightly decreases, while 3H uridine incorporation is considerably reduced. Divergence between the ploidy state, 3H AMD binding and 3H uridine incorporation can be due to the increment of the condensed chromatin area in differentiated cells. Plastids and mitochondria reach full maturity in 3-4 mm segment. The increasing volume density of ER and diminishing volume density of Golgi structures is accompanied by differentiation of cortex cells.     

Differential effects of deoxycholic acid on proliferation of neoplastic and differentiated colonocytes in vitro

The secondary bile acid deoxycholic acid is believed to be a promoter of large bowel cancer, in part by inducing colonic epithelial proliferation. The effects of deoxycholic acid on [3H]thymidine incorporation by the human colon cancer cell line HT29 and two differentiated subclones were measured and compared. The subclone HT29-C1 has features of mature absorptive cells and HT29-N2 cells secrete mucus under cholinergic control. The three cell lines were treated with deoxycholic acid (DCA) at concentrations of 0, 5, 10, 50, 100, 150, and 300 microM for 3, 6, 9, 15, 24, and 48 hr. A significant increase in proliferation was noted in HT29 cells only at 6 hr with 5 and 10 microM deoxycholic acid. Neither the subclone HT29-C1, nor HT29-N2 cells exhibited significant change in [3H]thymidine incorporation with DCA at these concentrations or time points. Higher doses of deoxycholic acid above 50 microM and duration of exposure greater than 24 hr were cytotoxic to all three cell lines. The proliferative effects of DCA in HT29 cells were not paralleled by changes in protein kinase C activity or protein kinase C isoform expression. Quantitative and qualitative differences in PKC isoform expression were not noted in the three cell lines used in this study. The proliferative effects of DCA on HT29 cells appear to be independent of the PKC signal transduction pathway.     

Selective deuteration of RNA for NMR signal assignment

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.     

Binding of an adenosine A1 receptor agonist and adenosine A1 receptor antagonist to sheep pineal membranes

The pineal organ of vertebrates produces melatonin and adenosine. In lower vertebrates, adenosine modulates melatonin production. We report herein that 2-chloro-cyclopentyl-[3H]-adenosine ([3H]CCPA: adenosine A1 receptor agonist) and [3H]-cyclopentyl-1,3-dipropylxanthine ([3H]DPCPX: adenosine A1 receptor antagonist), bind specifically to sheep pineal membranes. Binding of [3H]CCPA reached equilibrium at 90 min and dissociation revealed the presence of two components. Saturation analysis suggested the presence of a single population of binding sites (Kd = 1.67 +/- 0.06 nM, Bmax = 2386 fmol/mg protein). Binding was sensitive to GTP and GTPgammaS. Binding of [3H]DPCPX reached equilibrium at 60 min and dissociation was monophasic. Saturation analysis revealed a single population of binding sites (Kd = 5.8 +/- 1.12 nM, Bmax = 1116 fmol/mg protein). The specificity of the [3H]-analogues used and the rank order potency of the competitors tested in the competition experiments suggested the presence of A1 receptors. Future investigations are necessary to elucidate the significance of the differences observed between the binding properties of the adenosine A1 receptor agonist and adenosine A1 receptor antagonist.     

Lobeline and nicotine evoke [3H]overflow from rat striatal slices preloaded with [3H]dopamine: differential inhibition of synaptosomal and vesicular [3H]dopamine uptake

Lobeline is currently being developed as a substitution therapy for tobacco smoking cessation. Activation of CNS dopamine (DA) systems results in the reinforcing properties of nicotine. The present study compared the effects of lobeline and nicotine on rat striatum. Both lobeline and nicotine evoked [3H]overflow from striatal slices superfused in the presence of pargyline and nomifensine in the buffer. Marked DA depletion (42-67%) and a concomitant 2-fold increase in dihydroxyphenylacetic acid (DOPAC) in slices superfused with high concentrations (30-100 microM) of lobeline were observed. The effect of nicotine (10 microM) was inhibited in a concentration-dependent manner by mecamylamine (1-100 microM). However, lobeline (0.1-100 microM)-evoked [3H]overflow was calcium-independent, and was not antagonized by mecamylamine (1-100 microM), suggesting a mechanism of action other than stimulation of nicotinic receptors. Lobeline inhibited [3H]DA uptake into synaptosomes (IC50 = 80 +/- 12 microM) and vesicles (IC50 = 0.88 +/- 0.001 microM), whereas nicotine (< or =100 microM) did not inhibit synaptosomal or vesicular [3H]DA uptake. In the absence of pargyline and nomifensine in the buffer, endogenous DA was detected in superfusate only in those slices exposed to the highest concentration (100 microM) of lobeline. However, endogenous DOPAC concentration was increased in a concentration-dependent manner, indicating that lobeline exposure resulted in increased cytosolic DA which was rapidly metabolized to DOPAC. Under these conditions, lobeline (10-100 microM) also significantly depleted (66-85%) DA content; however, no change in DOPAC content was observed. The results suggest that, unlike nicotine, lobeline increases DA release by potent inhibition of DA uptake into synaptic vesicles, and a subsequent alteration in presynaptic DA storage.     

Effects of the trichothecene mycotoxin T-2 toxin on neurotransmitters and metabolites in discrete areas of the rat brain

Systemic exposure to T-2 toxin disrupts brain biogenic monoamine metabolism. Although the mechanisms underlying these neurochemical perturbations are unclear, we have suggested that they are a reflection of increased blood-brain barrier (BBB) permeability, or altered protein synthesis that affects brain enzyme activities. Accordingly, BBB permeability, in vitro protein synthesis and in vitro monoamine oxidase (MAO) activity were examined in rats after either acute, or 7-day exposure to T-2. Membrane permeability was assessed from the recovery of systemically administered [14C]mannitol and [14C]dextran with [3H]water as the diffusible reference, either 2 hr post-intraperitoneal (i.p.) injections of 0, 0.2 and 1 mg T-2/kg body weight or following a 7-day exposure to diets containing 0 and 10 ppm T-2. Protein synthesis, determined by [14C]leucine incorporation, and MAO activity, determined by H2O2 production, were observed either 2 hr post-ip injection of 0 and 1 mg T-2/kg body weight or following a 7-day exposure to diets containing 0, 2.5 and 10 ppm T-2. Permeability increases were observed in all brain regions examined for mannitol, but not for dextran following T-2 i.p. The effect of dietary T-2 was more modest, affecting mannitol uptake in two brain regions, the cerebellum and pons plus medulla regions. Protein synthesis was significantly decreased by i.p. administration of T-2, while dietary treatment significantly reduced MAO enzyme activity. Collectively, the effect of T-2 toxin on BBB permeability, protein synthesis and MAO enzyme activity may account for the neurochemical imbalance observed in T-2 intoxication.