Dissociation between the inhibitory and stimulatory effects of opioid peptides on cAMP formation in SK-N-SH neuroblastoma cells

This study compared the effects of human follicular fluid (hFF) from women with endometriosis, tubal factor and male factor on the zona binding capacity of human spermatozoa. Samples of hFF were collected from 30 patients, 10 patients for each of the indications of infertility, at the time of oocyte retrieval in an in-vitro fertilization/embryo transfer programme. The hemizona binding assay (HZA) was used to assess the effect of these hFF on the zona binding potential of human spermatozoa. The mean numbers of spermatozoa bound to the zona pellucida after treating the spermatozoa with hFF from endometriosis, tubal factor and male factor were 90.5 +/- 20.9, 108.9 +/- 22.3 and 101.2 +/- 13.4 respectively. These were significantly lower than their corresponding controls, the spermatozoa of which were incubated with Earle's balanced salt solution (endometriosis 238.7 +/- 34.7; tubal factor 210.8 +/- 41.6; male factor 205.4 +/- 26.3; P <0.002). The hemizona binding index (HZI) was similar between male factor samples (52.0 +/- 6.7) and tubal factor samples (53.8 +/- 4.2). Spermatozoa incubated with hFF from endometriosis patients (36.0 +/- 4.1) had an HZI that was significantly lower than those treated with hFF from tubal factor patients (P <0.01). Probably due to small sample size, the differences in HZI between endometriosis samples and male factor samples did not reach statistical significance (P = 0.076). These data suggest that there was a stronger sperm-zona binding inhibitory effect of hFF from patients with endometriosis than from those without the disease.     

Immunological identification of zona pellucida 2 (ZP2) protein in human oocytes

The ZP2 protein is a zona pellucida glycoprotein that plays a major role in fertilization. It mediates secondary binding of spermatozoa and is one of the proteins that are involved in zona 'hardening'. ZP2 proteins were identified in various mammalian zonae pellucidae. Their primary structures are highly conserved as revealed by cDNA cloning. Antisera were used against synthetic peptides generated either against a ZP2 amino acid that is homologous in human and mouse ZP2 amino acid sequences (AS ZP2-20) or antibodies against a synthetic human ZP2 peptide (AS ZP2-26). Immunoblots showed that antiserum AS ZP2-20 and AS ZP2-26 strongly recognized human ZP2 protein with an apparent molecular mass of about 72 kDa; both antisera reacted with a minor immunoreactive polypeptide at 96 kDa. In human ovary sections, both antisera revealed immunoreactivity to human zonae pellucidae. Immuno-electron microscopy demonstrated an equal distribution of ZP2 throughout the human zona pellucida. Considerable amounts of immunoreactive material were observed in the ooplasm; some ramification-like extensions of zona pellucida antigen were found close to cells surrounding the oocyte. Our results indicate that antisera against synthetic ZP2 peptides can be used as specific markers for the identification of ZP2 protein in human oocytes.     

Familial brain wave patterns: study of a 12-sib family

To identify peptide-specific antibodies which define sperm surface antigens, hybridomas were derived from the splenocytes of mice immunized with swollen human spermatozoa which had been subjected to limited proteolytic cleavage under reducing conditions prior to immunization. A total of 13.7% of the hybrid clones secreted antibodies which reacted with deglycosylated human seminal plasma glycoproteins when screened by an ELISA. A monoclonal antibody, designated mAb 4A8 sp., specifying a peptide epitope of human epididymal and a sperm surface glycoprotein was selected which inhibited human sperm-egg binding in a dose-dependent manner, and totally blocked sperm penetration in vitro. This inhibition did not result from an effect of the antibody on the motility of spermatozoa, nor was it due to premature induction of the acrosome reaction. Exclusion of oligosaccharide chains by chemical hydrolysis with trifluoromethane sulphonic acid (TFMS), enzymatic degradation and binding of lectins, did not abrogate the reactivity of mAb 4A8 to the cognate epitope whereas antibody binding was precluded upon digestion with proteolytic enzymes. In Western immunoblots of human seminal plasma glycoproteins, the antigen presented as a set of immunoreactive polypeptides, a major glycoprotein of M(r) 78 kDa and less prominent bands of M(r) 56 and 44 kDa. Immunocytochemical staining of a number of human reproductive and somatic tissues revealed strong immunostaining of the luminal epithelium of the epididymis as well as of spermatozoa in the lumen. Immunolocalization to the plasma membrane of ejaculated human spermatozoa was demonstrated by immunofluorescence, although on undigested spermatozoa the antigen epitope was less accessible. Upon capacitation the antigen persisted on the sperm surface and was present on the head of capacitated acrosome-intact spermatozoa. The pronounced peripheral immunostaining of the sperm head was accentuated after DTT/trypsin treatment, implicating the dynamic accessibility of the epitope on the plasma membrane of capacitated spermatozoa. It is suggested that the protein in question appears on the sperm membrane as a consequence of its modification in the epididymis (insertion and processing), and may be involved in the processes leading to sperm attachment and interaction with the human zona pellucida.     

Purification and characterization of protein D/E, a putative sperm-binding protein involved in fertilization

We describe a method for the efficient purification of a 32 Kd glycoprotein from rat epididymal tissue. The glycoprotein was purified by gel filtration, ion-exchange, affinity, and reverse phase high pressure liquid chromatography. The highly purified glycoprotein was radiolabeled with an iodinatable, cleavable, photoreactive cross-linking agent, 1-[N-(2-hydrox-5-azidobenzoyl)-2-aminoethyl]-4-(-hydroxysuccini mid yl)-succinate (HAHS). The soluble radiolabeled glycoprotein was bound to washed epididymal spermatozoa in a time-dependent, saturable, and reversible manner. Scatchard analysis demonstrates that there are approximately 3,403 binding sites/spermatozoon. The binding efficiency (Kd) for spermatozoa was approximately 2.0 x 10(-10) M. The function of this glycoprotein was verified by using an in vivo artificial insemination fertilization assay. The fertility rate for control spermatozoa was approximately 53%, but the rate for spermatozoa exposed to polyclonal anti-glycoprotein antibodies was only 5%. These data suggest that the binding of the glycoprotein to the surface of rat spermatozoa is mediated by a receptor-type mechanism and is involved in the fertilization process.     

Purification and characterization of a membrane-bound ATPase from Acetabularia cliftonii that corresponds to a Cl(-)-translocating ATPase in Acetabularia acetabulum

A Mg(2+)-ATPase was solubilized from membranes of Acetabularia cliftonii using nonanoyl-N-methylgluconamide and purified by ion-exchange and gel permeation chromatography. One active ATPase fraction after Mono Q chromatography had a specific activity of 10 units/mg of protein. Judged from subunit composition [54 (a), 50 (b) with a fainter band around 40 kDa], catalytic properties, and N-terminal amino acid sequence of the b subunit, the isolated enzyme was comparable to the Cl(-)-ATPase of Acetabularia acetabulum. Immunological characterization of both subunits showed significant similarity to the F type of ATPase. Cl(-)-transport activity was observed by reconstitution studies into liposomes.     

Factors influencing sperm-zona pellucida binding in vitro using the intact zona model

The zona pellucida binding assay assesses the ability of spermatozoa to bind to the zona pellucida. The present study investigated the influence of: (i) prior oocyte exposure to spermatozoa on subsequent sperm-zona pellucida binding in vitro; and (ii) cryopreservation of oocytes. Only oocytes obtained from fertile donors were used and the binding capacity of non-inseminated, cryopreserved oocytes was compared with both inseminated/unfertilized, cryopreserved oocytes and inseminated/unfertilized, non-cryopreserved oocytes recovered from in-vitro fertilization cultures on sperm-zona pellucida binding using an intact zona model. There was no statistically significant difference in sperm-zona binding between non-inseminated, cryopreserved oocytes (range 9.6-23.2), inseminated/unfertilized, cryopreserved oocytes (range 15.0-16.0) and inseminated/ unfertilized, non-cryopreserved oocytes (range 3.3-23.0). The coefficient of variation for sperm binding to all oocyte groups was very large (range 37-121%). We conclude that neither prior exposure of human oocytes to human spermatozoa nor cryopreservation of human oocytes influences the subsequent binding of a different population of spermatozoa to the zona pellucida. However, large oocyte-to-oocyte variation of sperm-zona binding may diminish the usefulness of this assay in clinical practice and as a research tool.     

A double-blind randomized placebo cross-over controlled trial using the antioxidant vitamin E to treat reactive oxygen species associated male infertility

OBJECTIVE: To determine the effectiveness of the in vivo administration of vitamin E as treatment for reactive oxygen species-associated male infertility. SETTING: University-based center for reproductive medicine. DESIGN: Double-blind randomized placebo cross-over controlled trial. PATIENTS, PARTICIPANTS: Thirty healthy men with high levels of reactive oxygen species generation in semen and a normal female partner. INTERVENTIONS: Patients were allocated to two groups according to the blinded randomization. Each patient received either 600 mg/d of vitamin E (Ephynal, 300 mg tablets; F. Hoffman-La Roche Ltd., Basle, Switzerland) (order A) or identical placebo tablets (order B) for 3 months. Then after a 1-month wash-out period the patients were crossed-over to the other treatment. MAIN OUTCOME MEASURES: Improvement in the in vitro function of the spermatozoa measured by conventional semen analysis, computerized motility assessment, determination of reactive oxygen species generation, binding to the zona pellucida of the unfertilized human oocyte in a competitive zona binding assay, development of hyperactivated motility (both spontaneous and in the presence of 20% of the natural agonist, human follicular fluid) and pregnancy. RESULTS: Rise in the blood serum vitamin E levels after treatment accompanied by improvement in one of the sperm function tests: the zona binding assay. The zona binding ratio for order A improved from 0.2 (range 0 to 0.5) before treatment to 0.5 (range 0.1 to 1.0) after treatment, the corresponding values for order B were 0.2 (range 0 to 1.0) before treatment and 0.3 (range 0.1 to 0.7) after treatment. CONCLUSION: Oral administration of vitamin E significantly improves the in vitro function of human spermatozoa as assessed by the zona binding test.     

Isolation and purification of a high molecular weight substance from human urine which inhibits calcium oxalate crystal growth

A high molecular weight inhibitor of calcium oxalate crystal growth in human urine was investigated. Three inhibitors were isolated by DEAE-Sephacel ion-exchange chromatography and, of these, the substance we named "Peak 3 protein" seemed to be the main inhibitor in human urine. Peak 3 protein and several was purified by fast protein liquid chromatography and polyacrylamide gel electrophoresis. This substance, with a molecular weight of 30 kDa, did not contain uronic acid and its inhibitory activity decreased after digestion with proteinase. The difference between Peak 3 protein and several inhibitors previously reported was investigated but no clear difference could be found. The fact that it was the protein structure which was responsible for the inhibitory activity and the fact that Peak 3 protein probably possessed many side-chains which did not contribute to the inhibitory activity influenced the outcome of the investigation.     

Molecular cloning, expression, and partial characterization of a second human tissue-factor-pathway inhibitor

Previous studies have shown that tissue-factor-pathway inhibitor (TFPI) is an important regulator of the extrinsic pathway of blood coagulation through its ability to inhibit factor Xa and factor VIIa-tissue factor activity. We describe the molecular cloning and expression of a full-length cDNA that encodes a molecule, designated TFPI-2, that has a similar overall domain organization and considerable primary amino acid sequence homology to TFPI. After a 22-residue signal peptide, the mature protein contains 213 amino acids with 18 cysteines and two canonical N-linked glycosylation sites. The deduced sequence of mature TFPI-2 revealed a short acidic amino-terminal region, three tandem Kunitz-type domains, and a carboxyl-terminal tail highly enriched in basic amino acids. Northern analysis indicates that TFPI-2 is transcribed in umbilical vein endothelial cells, liver, and placenta. TFPI-2 was expressed in baby hamster kidney cells and purified from the serum-free conditioned medium by a combination of heparin-agarose chromatography, Mono Q FPLC, Mono S FPLC, and Superose 12 FPLC. Purified TFPI-2 migrated as a single band in SDS/PAGE and exhibited a molecular mass of 32 kDa in the presence and absence of reducing agent. The amino-terminal sequence of recombinant TFPI-2 was identical to that predicted from the cDNA. Despite its structural similarity to TFPI, the purified recombinant TFPI-2 failed to react with polyclonal anti-TFPI IgG. Preliminary studies indicated that purified recombinant TFPI-2 strongly inhibited the amidolytic activities of trypsin and the factor VIIa-tissue factor complex. In addition, the inhibition of factor VIIa-tissue factor amidolytic activity by recombinant TFPI-2 was markedly enhanced in the presence of heparin. TFPI-2 at high concentrations weakly inhibited the amidolytic activity of human factor Xa, but had no measurable effect on the amidolytic activity of human thrombin.     

T-cell receptor-mediated signal transduction in transformed human T-cells

Carbonated apatite (dahllite) is formed within and between collagen fibrils in the mineralization of connective tissues. However, the mechanism of crystal nucleation at these sites has not been resolved. To identify non-collagenous proteins that may be involved in the nucleation process we have utilized a dissociative extraction procedure to isolate proteins associated non-covalently with the de-mineralized collagen matrix of dentine isolated from tooth roots of adult porcine incisors. Following extraction of dentine fragments with 4M GuHCl (G1-extract) and 0.5M EDTA (E-extract), de-mineralized collagen matrix-associated proteins were isolated with a second series of extractions with 4M GuHCl (G2-extract). Analysis of the G2-extracts on SDS-PAGE revealed two major 32 kDa and 24 kDa protein bands, comprising > 80% of the extracted non-collagenous proteins. The 32 kDa protein was purified by FPLC on hydroxyapatite and Mono Q resins, followed by HPLC reverse-phase chromatography. Small amounts of 26 kDa and 6 kDa proteins, which appear to represent proteolytically processed, disulphide-linked fragments of the 32 kDa protein, co-eluted with the major protein. The 32 kDa protein was identified as lysyl oxidase from amino acid sequence analysis of a 13 kDa CNBr peptide obtained from protein purified by preparative electrophoresis on SDS-PAGE. Fractionation of the 24 kDa protein on FPLC Mono Q resin generated < 5 closely eluting protein peaks. The proteins from these peaks were similar in size, staining properties, amino acid composition and CNBr digestion patterns. Each protein was immunoreactive with antibodies raised against a tyrosine-rich acidic matrix protein (TRAMP), reported previously to co-purify with lysyl oxidase. These studies, therefore, show that lysyl oxidase, which is important in collagen cross-link formation, and proteins with properties of TRAMP, a protein that can modulate collagen fibrillogenesis, are the major proteins in dissociative extracts of de-mineralized porcine dentine.     

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.     

Purification and characterization of an allergy-induced melanogenic stimulating factor in brownish guinea pig skin

We have demonstrated recently that phenylazonaphthol (PAN) allergy-induced hyperpigmentation in brownish guinea pig skin is associated with the concomitant appearance of a melanogenic soluble factor(s) that activates the intracellular signal transduction system, including phosphatidylinositol turnover subsequent to ligand-receptor binding in cultured guinea pig melanocytes. In this study we have purified and characterized the PAN-induced melanogenic stimulating factor (PIMSF) that occurs in allergy-associated hyperpigmented skin. By successive column chromatography on TSK 2000SW, Mono Q, and octadecyl-NPR, the PIMSF was purified to homogeneity with a single band of apparent molecular mass of 7.9 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The specific bioactivity of PIMSF increased by 5,195-fold over the original skin homogenate. In cultured guinea pig melanocytes, this purified PIMSF had the potential of activating an intracellular signal transduction system such as inositol 1,4,5-trisphosphate formation and intracellular calcium levels through a pertussis toxin-sensitive G protein-coupled receptor. PIMSF consistently caused a rapid translocation of cytosolic protein kinase C (PKC) to membrane-bound PKC within 5 min of treatment with a return to the basal level after 120 min. The stimulating effects of PIMSF on proliferation and melanization of cultured guinea pig melanocytes were abolished completely by a PKC down-regulating agent (phorbol 12,13-dibutyrate). PIMSF was similar in molecular mass to rat growth-related oncogene alpha (GRO-alpha; molecular mass of 7.9 kDa) on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and had immunocross-reactivity with GRO-alpha upon Western immune blotting analysis. Further, the stimulatory effect of purified PIMSF on DNA synthesis of cultured guinea pig melanocytes was suppressed markedly by the addition of anti-rat GRO-alpha antibody, implying that the PIMSF is apparently identical to GRO-alpha. These findings suggest that PAN allergy provides a new mechanism of hyperpigmentation in which biological factors such as the GRO-alpha superfamily generated within allergy-induced skin stimulate melanocytes through activation of the PKC-related signal transduction pathway.     

Multiple forms of human acrosin: isolation and properties

Human acrosin was purified to electrophoretically homogeneous forms by acidic extraction of washed ejaculated spermatozoa and gel filtration of the acidic extracts on Sephadex G-75, followed by affinity chromatography on p-amino-benzamidine Sepharose. Human acrosin exists in at least four molecular forms. The apparent molecular weights of three forms were determined to be 64 000, 38 000 and 25 000, respectively. The high molecular weight form is transformed to the low molecular weight forms by incubation of the acrosin preparation obtained from freshly ejaculated spermatozoa in solutions of pH near 7. Like boar acrosin, human acrosin is also a glycoprotein and therefore reversibly bound to Concanavalin A-Sepharose. The amino acid composition of the 25 000 molecular weight form is similar to that of human trypsin. Rabbit anti-boar-acrosin gamma-globulins form a precipitate with human acrosin, but not with porcine trypsin or human plasmin. The relationship between the occurrence of multiple acrosin forms and proenzyme activation by limited proteolysis is discussed.     

A novel endonuclease from kinetoplastid hemoflagellated protozoan parasite Leishmania

A nuclease activity has been purified from the nuclei-kinetoplast fraction of Leishmania. This enzyme, termed endonuclease M (Endo M), is shown by electrophoresis in a denaturing polyacrylamide gel to be associated with a single polypeptide of molecular mass 52 kDa. Physical analysis of the enzyme indicates that it has a sedimentation coefficient S20,w of 4.5S, a Stoke's radius of 32.5 A, and a native molecular mass of 53 kDa. The final Mono Q purified Endo M possesses both DNase and RNase activities. It acts as an endonuclease by introducing random single-stranded nicks into the supercoiled DNA molecules, that often leads to its linearization due to nicking at the opposite strands, and subsequent degradation of the DNA with further incubation. Single-stranded DNA is twice preferred to double-stranded DNA as substrate. Single-stranded RNA is also degraded rapidly and is competitive as a substrate with single-stranded DNA. RNA:DNA hybrids, however, are largely resistant to the Endo M digestion.     

A 50-kDa variant form of human surfactant protein D

The dominant form of human surfactant protein D (SP-D) is a multimeric collagenous glycoprotein composed of monomeric subunits that have a molecular mass of 43 kDa under reducing conditions. However, in evaluating monoclonal antibodies to human SP-D, an additional monomeric subunit was identified with a reduced molecular mass of 50 kDa. This 50-kDa variant was detected in approximately half of the samples evaluated and was found in lavage fluid from normal subjects, patients with alveolar proteinosis or idiopathic pulmonary fibrosis and in amniotic fluid. This 50-kDa variant had the same amino-terminal sequence, amino acid composition and apparent size of the carboxy-terminal collagenase-resistant fragment (20 kDa) as the 43-kDa subunit. The major difference was in the amino-terminal portion of the molecule and was due to altered glycosylation, as determined by carbohydrate staining, chemical deglycosylation, treatment with N-glycanase and neuraminidase and reduced signals for threonine at positions 5, 9 and 10 during amino-terminal sequencing. After gel filtration chromatography, the 50-kDa form was not present in the high molecular weight fraction, which is commonly used in purification of SP-D, but was found only in the smaller molecular weight fraction of monomers and trimers of SP-D. In conclusion, the 50 kDa-form of surfactant protein D is produced by post-translational glycosylation and does not form higher ordered oligomers, but its precise physiological function remains to be determined.     

Isolation and characterization of maturation inhibiting compound in bovine follicular fluid

The protein fraction which is responsible for the inhibition of maturation of bovine oocytes in vitro was isolated from cow follicular fluid by means of column chromatography on a Sephadex G-200 and a Sepharose 4B, both in 0.1 M ammonium acetate, pH 6.7. The molecular weight of the maturation inhibiting protein fraction is approximately 60 kDa. At a concentration of 2.0 mg/mL in cultivation medium, 100% of the oocytes were arrested at the germinal vesicle stage. At a concentration of 0.25 mg/mL, the protein fraction still had some meiosis inhibiting effects, but 56% of the oocytes were capable of maturing to the metaphase of the second meiosis (MII). Without compact cumulus the inhibiting fraction had no meiosis retarding effect on the oocytes. Cow follicular fluid also exhibited this inhibitory effect on oocyte maturation in vitro. However, the follicular fluid from follicles of 2.5-5.0 mm diameter showed higher meiosis inhibiting effects than the follicular fluid from follicles of 5-10 mm diameter.     

Diversity of the blocking effects of antisperm antibodies on fertilization in human and mouse

The blocking effects of complement-dependent sperm immobilizing antibodies in the sera of infertile women and monoclonal antisperm antibodies against humans and mice on fertilization were investigated. The hemizona assay (HZA) and sperm penetration assay (SPA) were used to study the inhibitory effects of sera from 22 infertile patients positive for sperm immobilizing antibodies. Use of these tests allowed us to differentiate whether the antibody blocked sperm-zona pellucida tight binding and/or sperm penetration into the ooplasm. The zona pellucida penetration assay (ZPA) was also used to study the effects of four monoclonal antibodies (mAbs) on human sperm penetration into the zona pellucida. Seven mAbs against murine spermatozoa were tested for their inhibitory effects on in-vitro fertilization (IVF) and HZA in mice. Of 22 patient sera with sperm immobilizing antibodies, 21 (95.5%) inhibited HZA attachment and penetration, whereas this did not occur in any of 13 patient sera without these antibodies. However, 19 of 22 (86.4%) patient sera with sperm immobilizing antibodies and eight of 13 (61.5%) patient sera without these antibodies inhibited the SPA. Two (2C6, 1G12) of four mAbs against human spermatozoa showed strong inhibitory effects in all the assays (HZA, ZPA and SPA). One mAb (3B10) did not inhibit HZA but blocked ZPA and SPA. Another mAb (H6-3C4) seemed to have no inhibitory effects on fertilization. Two (Vx 5 and Vx 8) of seven mAbs against murine spermatozoa inhibited IVF in mice but did not block mouse HZA. These findings suggest that antisperm antibodies block fertilization at specific stages. Some of them may inhibit sperm capacitation and thus prevent all processes of fertilization that follow. Some other antibodies may not affect capacitation and sperm binding to zona pellucida but inhibit the acrosome reaction, followed by the blocking of sperm penetration through zona pellucida and ooplasm.     

Isolation and characterization of an intracellular serine proteinase inhibitor from a monkey kidney epithelial cell line

A recent report described a thrombin inhibitory activity in the soluble fraction of human placenta and the cytosolic fraction of K562 cells. Isolation and characterization of the functionally inactive 35-38-kDa placental form of this protein revealed that it was a novel serine proteinase inhibitor (Coughlin, P. B., Tetaz, T., and Salem, H. H. (1993) J. Biol. Chem. 268, 9541-9547). In the present study, we observed a 67-kDa sodium dodecyl sulfate (SDS)-stable complex when 125I-thrombin was incubated with the cytosolic fraction of a monkey kidney epithelial cell line, BSC-1. This complex was not observed in either the particulate cell fraction extracted with 0.2% Triton X-100 or medium conditioned by cells, suggesting that the thrombin-complexing factor is confined to the cytoplasm. The cytoplasmic antithrombin activity was purified to apparent homogeneity from the cytosol of BSC-1 cells previously pulsed with [35S]methionine by a combination of heparin-agarose chromatography, Mono Q fast protein liquid chromatography, and anhydrotrypsin-Affi-Gel 10 affinity chromatography. Analysis of the affinity-purified preparation by SDS-polyacrylamide gel electrophoresis and fluorography revealed a single protein with an apparent molecular mass of 38 kDa. The purified 38-kDa protein inhibited the amidolytic activities of thrombin, trypsin, urokinase, and factor Xa but not that of elastase. Incubation of the 38-kDa protein with excess thrombin identified approximately 60% of the labeled 38-kDa protein in an SDS-stable 67-kDa complex. The purified 38-kDa inhibitor was cleaved with cyanogen bromide and the isolated peptides subjected to microsequencing. Amino acid sequence obtained for a region within this protein exhibited significant homology with human antithrombin III and plasminogen activator inhibitors 1 and 2. This homologous peptide contained the full complement of residues designated as highly conserved in helix F of the greater serine proteinase inhibitor superfamily. In addition, an internal sequence of GGGGDIHQGF was found in the monkey cytoplasmic inhibitor, which is identical to that reported for an internal sequence of the human placental inhibitor. These findings confirm the existence of a novel cytoplasmic serine proteinase inhibitor in mammalian cells and provide additional details of its molecular properties. The physiological function of this novel serine proteinase inhibitor in cytoplasm is unknown.     

Induction of the human sperm acrosome reaction with mannose-containing neoglycoprotein ligands

In the interest of classifying cases of male factor infertility, we have paid particular attention to the sugar ligand binding properties of the human sperm surface and the functional capacity of the acrosome for exocytosis--key parameters for assessing sperm fertilizing ability. Zona recognition and binding involve the interactions of sperm surface mannose receptors (lectins) with mannose ligands on the zona pellucida. Sperm surface mannose lectins can be visualized by their ability to bind a synthetic model zona ligand, fluorescein isothiocyanate (FITC)-conjugated mannosylated bovine serum albumin (BSA) (Man-FITC-BSA). We now report that Man-FITC-BSA biologically also mimics the effects of solubilized authentic human zonae, in that binding of Man-FITC-BSA results in a time-dependent receptor aggregation and the induction of acrosome exocytosis in capacitated sperm populations from fertile donors. In our assay, the addition of mM amounts of mannose monosaccharide to Man-FITC-BSA increases the number of polyvalent mannose ligands bound by individual spermatozoa and increases the rate of the acrosome reactions induced by Man-FITC-BSA, thereby increasing specimen processing efficiency. We conclude that exposure of human spermatozoa to polyvalent mannose ligands + D-mannose monosaccharide offers a new, convenient and readily available system to study sperm capacity for induced acrosome loss.