Steric factors controlling the surface hybridization of PCR amplified sequences

This study elucidated the hybridization behavior of surface-bound oligonucleotides to their longer PCR-amplified targets. The screen-printed gold surface of disposable electrodes was the platform onto which thiol-tethered oligonucleotides (21-mer) were immobilized by chemisorption. As a model case, approximately 600-bp amplicons were studied. Surface hybridization was monitored by means of an enzyme-linked assay with electrochemical detection. Use of different surface-tethered probe sequences over a wide range of surface densities was explored to achieve the highest duplex yield. Both the surface coverage by the probe and its relative position on the target strand were found to control the efficiency of capture of the target sequence. Interfacial hybridization occurred with the highest efficiency for a probe coverage of approximately 2.9 x 10(12) molecules/cm2 and when the 3' end of the amplicon was involved. An unusual (bell-shaped) response/amplicon concentration profile was additionally found. It was hypothesised that when the amount of solution-phase target is relatively high, random collisions make reannealing of the approximately 600-bp strands favored over formation of the surface-tethered probe-amplicon complex. This paper also describes a strategy to enhance the sensitivity of enzyme-linked hybridization assays. Such a strategy relies on formation, around the long target sequence, of dendritic-like structures, which could offer multiple anchoring points for the enzyme conjugate. The results shown in this work might have great significance for the practical application of hybridization to oligonucleotide chips.     

Protein detection based on small molecule-linked DNA

Based on small molecule-linked DNA and the nicking endonuclease-assisted amplification (NEA) strategy, a novel electrochemical method for protein detection is proposed in this work. Specifically, the small molecule-linked DNA (probe 1) can be protected from exonuclease-catalyzed digestion upon binding to the protein target of the small molecule, so the DNA strand may hybridize with another DNA strand (probe 2) that is previously immobilized onto an electrode surface. Consequently, the NEA process is triggered, resulting in continuous removal of the DNA strands from the electrode surface, and the blocking effect against the electrochemical species [Fe(CN)(6)](3-/4-) becomes increasingly lower; thus, increased electrochemical waves can be achieved. Because the whole process is activated by the target protein, an electrochemical method for protein quantification is developed. Taking folate receptor (FR) as an example in this work, we can determine the protein in a linear range from 0.3 to 15 ng/mL with a detection limit of 0.19 ng/mL. Furthermore, because the method can be used for the assay of FR in serum samples and for the detection of other proteins such as streptavidin by simply changing the small molecule moiety of the DNA probes, this novel method is expected to have great potential applications in the future.     

Electrochemical biosensor for detection of BCR/ABL fusion gene using locked nucleic acids on 4-aminobenzenesulfonic acid-modified glassy carbon electrode

In this study, an electrochemical DNA biosensor was developed for detection of the breakpoint cluster region gene and the cellular abl (BCR/ABL) fusion gene in chronic myelogenous leukemia by using 18-mer locked, nucleic acid-modified, single-stranded DNA as the capture probe. The capture probe was covalently attached on the sulfonic-terminated aminobenzenesulfonic acid monolayer-modified glassy carbon electrode through the free amines of DNA bases based on the acyl chloride cross-linking reaction. The covalently immobilized capture probe could selectively hybridize with its target DNA to form double-stranded DNA (dsDNA) on the LNA/4-ABSA/GCE surface. Differential pulse voltammetry was used to monitor the hybridization reaction on the capture probe electrode. The decrease of the peak current of methylene blue, an electroactive indicator, was observed upon hybridization of the probe with the target DNA. The results indicated that, in pH 7.0 Tris-HCl buffer solution, the peak current was linear with the concentration of complementary strand in the range of 1.0 x 10 (-12)1.1 x 10 (-11) M with a detection limit of 9.4 x 10 (-13) M. This new method demonstrates its excellent specificity for single-base mismatch and complementary dsDNA after hybridization, and this probe has been used for assay of PCR real sample with satisfactory results.     

"Off-On" Electrochemical Hairpin-DNA-Based Genosensor for Cancer Diagnostics

A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.     

Label-free DNA detection based on modified conducting polypyrrole films at microelectrodes

A label-free electrochemical detection method for DNA hybridization based on electrostatic modulation of the ion-exchange kinetics of a polypyrrole film deposited at microelectrodes is reported. Synthetic single-stranded 27-mer oligonucleotides (probe) have been immobilized at 2,5-bis(2-thienyl)-N-(3-phosphorylpropyl)pyrrole film formed by electropolymerization on the previously formed polypyrrole layer. The 27- or 18-mer target oligonucleotides were monitored via the electrochemically driven anion exchange of the inner polypyrrole film. The performance of the miniaturized DNA biosensor system was studied in respect to selectivity, sensitivity, reproducibility, and regeneration of the sensor. Control experiments were performed with a noncomplementary target of 27-mer DNA and 12 base-pair mismatched 18-mer sequences, respectively, and did not show any unspecific binding. Under optimized experimental conditions, the label-free electrochemical biosensor enabled the detection limits of 0.16 and 3.5 fmol for the 18- and 27-mer DNA strand, respectively. Furthermore, we demonstrate reusability of the electrochemical DNA biosensor after successful recovery of up to 100% of the original signal by regenerating the DNA "label-free" electrode with 50 mM HCl at room temperature.     

Unlabeled hairpin-DNA probe for the detection of single-nucleotide mismatches by electrochemical impedance spectroscopy

An unlabeled hairpin-DNA probe was used for the detection of eight single-nucleotide mismatches by electrochemical impedance spectroscopy (EIS). Upon hybridization of the target strand with the hairpin DNA probe, the stem-loop structure is opened and forms a duplex DNA. Accordingly, the film thickness is increased, which causes differences in the electrical properties of the film before and after hybridization. Randles equivalent circuits were employed to evaluate the EIS result. The differences in the charge-transfer resistance DeltaR(CT) between hairpin DNA (before hybridization) and duplex DNA (after hybridization) shows the consequence of a large structural rearrangement from hairpin to duplex. If a single-nucleotide mismatch is present in the center of the duplex, the difference in charge-transfer resistance DeltaR(CT) between B-DNA in the absence and presence of Zn(2+) allows the unequivocal detection of all eight single-nucleotide mismatches. The detection limit was measured, and DeltaR(CT) allows the discrimination of a single-nucleotide mismatch with the concentration of the target strand as low as 10 pM.     

Structure and DNA hybridization properties of mixed nucleic acid/maleimide-ethylene glycol monolayers

The surface structure and DNA hybridization performance of thiolated single-strand DNA (HS-ssDNA) covalently attached to a maleimide-ethylene glycol disulfide (MEG) monolayer on gold have been investigated. Monolayer immobilization chemistry and surface coverage of reactive ssDNA probes were studied by X-ray photoelectron spectroscopy and time-of-flight secondary ion mass spectrometry. Orientation of the ssDNA probes was determined by near-edge X-ray absorption fine structure (NEXAFS). Target DNA hybridization on the DNA-MEG probe surfaces was measured by surface plasmon resonance (SPR) to demonstrate the utility of these probe surfaces for detection of DNA targets from both purified target DNA samples and complex biological mixtures such as blood serum. Data from complementary techniques showed that immobilized ssDNA density is strongly dependent on the spotted bulk DNA concentration and buffer ionic strength. Variation of the immobilized ssDNA density had a profound influence on the DNA probe orientation at the surface and subsequent target hybridization efficiency. With increasing surface probe density, NEXAFS polarization dependence results (followed by monitoring the N 1s --> pi* transition) indicate that the immobilized ssDNA molecules reorient toward a more upright position on the MEG monolayer. SPR assays of DNA targets from buffer and serum showed that DNA hybridization efficiency increased with decreasing surface probe density. However, target detection in serum was better on the "high-density" probe surface than on the "high-efficiency" probe surface. The amounts of target detected for both ssDNA surfaces were several orders of magnitude poorer in serum than in purified DNA samples due to nonspecific serum protein adsorption onto the sensing surface.     

Sequence-specific electrochemical detection of asymmetric PCR amplicons of traditional Chinese medicinal plant DNA

In this study, an electrochemistry-based approach to detect nucleic acid amplification products of Chinese herbal genes is reported. Using asymmetric polymerase chain reaction and electrochemical techniques, single-stranded target amplicons are produced from trace amounts of DNA sample and sequence-specific electrochemical detection based on the direct hybridization of the crude amplicon mix and immobilized DNA probe can be achieved. Electrochemically active intercalator Hoechst 33258 is bound to the double-stranded duplex formed by the target amplicon hybridized with the 5'-thiol-derivated DNA probe (16-mer) on the gold electrode surface. The electrochemical current signal of the hybridization event is measured by linear sweep voltammetry, the response of which can be used to differentiate the sequence complementarities of the target amplicons. To improve the reproducibility and sensitivity of the current signal, issues such as electrode surface cleaning, probe immobilization, and target hybridization are addressed. Factors affecting hybridization efficiency including the length and binding region of the target amplicon are discussed. Using our approach, differentiation of Chinese herbal species Fritillaria (F. thunbergii and F. cirrhosa) based on the 16-mer unique sequences in the spacer region of the 5S-rRNA is demonstrated. The ability to detect PCR products using a nonoptical electrochemical detection technique is an important step toward the realization of portable biomicrodevices for on-spot bacterial and viral detections.     

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.     

Reusable electrochemical sensing platform for highly sensitive detection of small molecules based on structure-switching signaling aptamers

Aptamers are nucleic acids that have high affinity and selectivity for their target molecules. A target may induce the structure switching from a DNA/DNA duplex to a DNA/target complex. In the present study, a reusable electrochemical sensing platform based on structure-switching signaling aptamers for highly sensitive detection of small molecules is developed using adenosine as a model analyte. A gold electrode is first modified with polytyramine and gold nanoparticles. Then, thiolated capture probe is assembled onto the modified electrode surface via sulfur-gold affinity. Ferrocene (Fc)-labeled aptamer probe, which is designed to hybridize with capture DNA sequence and specifically recognize adenosine, is immobilized on the electrode surface by hybridization reaction. The introduction of adenosine triggers structure switching of the aptamer. As a result, Fc-labeled aptamer probe is forced to dissociate from the sensing interface, resulting in a decrease in redox current. The decrement of peak current is proportional to the amount of adenosine. The present sensing system could provide both a wide linear dynamic range and a low detection limit. In addition, high selectivity, good reproducibility, stability, and reusability are achieved. The recovery test demonstrates the feasibility of the designed sensing system for an adenosine assay.     

Study on the dynamic behavior of a DNA microarray

A theoretical dynamic kinetic model was derived and a series of experiments were carried out using low-density microarrays in various concentrations of spotting probe ([P]) and labeling target ([T]). It has been shown that target and probe determined the signal intensity together. At a certain range of DNA concentration, the signal intensity was in proportion to spotting [P]. At the higher DNA concentrations, there was a decrease in hybridization signal intensity, especially in cDNA microarrays. Since the DNA microarray was constructed on a solid surface, steric hindrance, which is induced by the solid surface and the high [P], decreased the probe immobilization efficiency, leading to a decrease of the immobilized probe density. The decreased hybridization efficiency also caused the compression in signal intensity when the target increased. Nevertheless, the intensity ratio of Cy5 to Cy3 was not compressed within a microarray in the two-color system. The ratio of Cy5/Cy3 is only determined by the ratio of two targets and independent of the density and the types of probe. Therefore, the two-color fluorescent strategy is more reasonable and reliable in detection of differential gene expression. All these results indicate that the DNA microarray can be used to detect differently expressed genes, though it cannot be used to detect the absolute mRNA abundance.     

Enzyme-amplified electrochemical detection of DNA using electrocatalysis of ferrocenyl-tethered dendrimer

We have developed a sandwich-type enzyme-linked DNA sensor as a new electrochemical method to detect DNA hybridization. A partially ferrocenyl-tethered poly(amidoamine) dendrimer (Fc-D) was used as an electrocatalyst to enhance the electronic signals of DNA detection as well as a building block to immobilize capture probes. Fc-D was immobilized on a carboxylic acid-terminated self-assembled monolayer (SAM) by covalent coupling of unreacted amine in Fc-D to the acid. Thiolated capture probe was attached to the remaining amine groups of Fc-D on the SAM via a bifunctional linker. The target DNA was hybridized with the capture probe, and an extension in the DNA of the target was then hybridized with a biotinylated detection probe. Avidin-conjugated alkaline phosphatase was bound to the detection probe and allowed to generate the electroactive label, p-aminophenol, from p-aminophenyl phosphate enzymatically. p-Aminophenol diffuses into the Fc-D layer and is then electrocatalytically oxidized by the electronic mediation of the immobilized Fc-D, which leads to a great enhancement in signal. Consequently, the amount of hybridized target can be estimated using the intensity of electrocatalytic current. This DNA sensor exhibits a detection limit of 20 fmol. Our method was also successfully applied to the sequence-selective discrimination between perfectly matched and single-base mismatched target oligonucleotides.     

Direct DNA hybridization detection based on the oligonucleotide-functionalized conductive polymer

Electrochemical methods for DNA hybridization detection have many advantages that are very fast to detect hybridization and can be directly applied for a portable DNA sensor. In this paper, an electrochemical method to directly detect DNA hybridization was developed on the basis of a new conductive polymer, which was polymerized on the glassy carbon electrode with a terthiophene monomer having a carboxyl group (3'-carboxyl-5,2',5',2"-terthiophene). The ss-DNA probe was made by chemically bonding an amine-linked C6 alkyl group to the 5' terminus of oligonucleotide (19-mer). The probe moiety was immobilized on the polymer through covalent bonding with a catalyst, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide. A difference in admittance was observed before and after hybridization as a result of the reduction of the resistance after hybridization. The highest difference in admittance was observed around 1 kHz before and after hybridization. Hybridization amounts of end two-base and center one-base mismatched sequences were obtained only in a 14.3% response when compared to that for the complementary matched sequence.     

Electrochemical biosensor for detection of adenosine based on structure-switching aptamer and amplification with reporter probe DNA modified Au nanoparticles

In the present study, an electrochemical sensing strategy for highly sensitive detection of small molecules was developed based on switching structures of aptamers from DNA/DNA duplex to DNA/target complex. A gold electrode was first modified with gold nanoparticles (AuNPs), and thiolated capture probe was immobilized onto the electrode via sulfur-gold affinity. Then, a "sandwich-type" strategy was employed, which involved a linker DNA containing antiadenosine aptamer sequence and reporter DNA loaded on AuNPs. In the presence of adenosine, the aptamer part bound with adenosine and folded to the complex structure. As a result, the reporter probes together with AuNPs were released into solution and reduced a decrease in peak current. With the enhancement effect of AuNPs, a detection limit as low as 1.8 x 10(-10) M for adenosine was achieved. The sensor exhibited excellent selectivity against other nucleosides and could be used to detect adenosine from real human serum samples.     

Label-free electrochemical hybridization genosensor for the detection of hepatitis B virus genotype on the development of Lamivudine resistance

The resistance analysis related to the hepatitis B virus (HBV) genotyping and treatment procured key information for the study of infected patients. The aim of this study was to develop a novel assay for the voltammetric detection of DNA sequences related to the HBV genotype on the development of lamuvidine resistance by monitoring the oxidation signal of guanine. This new technique not only provides a rapid, cost-effective, simple analysis but also gives information concerning both genotyping and lamivudine resistance. Synthetic single-stranded oligonucleotides ("probe") including YMDD (HBV wild type) YVDD, or YIDD (mutations in the YMDD) variants have been immobilized onto pencil graphite electrodes with the adsorption at a controlled potential. The probes were hybridized with different concentrations of their complementary ("target") sequences such as synthetic complementary sequences, clonned PCR products, or real PCR samples. The formed synthetic hybrids on the electrode surface were evaluated by a differential pulse voltammetry technique using a label-free detection method. The oxidation signal of guanine was observed as a result of the specific hybridization between the probes and their synthetic targets and specific PCR products. The response of the hybridization of the probes with their single-base mismatch oligonucleotides at PGE was also detected. Control experiments using the noncomplementary oligonucleotides were performed to determine whether the DNA genosensor responds selectively. Numerous factors, affecting the probe immobilization, target hybridization, and nonspecific binding events, were optimized to maximize the sensitivity and reduce the assay time. Under the optimum conditions, 457 fmol/mL was found as the detection limit for target DNA. With the help of the appearance of the guanine signal, the new protocol is based on the electrochemical detection of HBV genotype for the development of lamuvidine resistance for the first time. Features of this protocol are discussed and optimized.     

Electrochemical characterization of deoxyribonucleic acid on aluminum(III)/poly(l-glutamic acid) film and its application for the detection of phosphinothricin acetyltransferase gene-specific sequence

A simple strategy of transgenic sequence-specific detection without a special amplification procedure was developed on the basis of aluminum(III)/poly(l-glutamic acid) (PLGA) film. An aluminum ion (Al(III)) thin film was assembled on the surface of PLGA via the electrostatic binding of Al(III) with carboxyl, namely Al(III)/PLGA. The immobilization of deoxyribonucleic acid (DNA) was carried out on this Al(III)/PLGA film by Al(III)-single strand DNA (ssDNA) interaction. Surface hybridization between the immobilized ssDNA and its complementary ssDNA was monitored by electrochemical impedance spectroscopy (EIS) using [Fe(CN)₆]^3−/4− as a redox probe. Under the optimal conditions, this DNA electrochemical sensor was applied to determine the specific gene sequence related to phosphinothricin acetyltransferase transgene (PAT) in the transgenic plants by label-free EIS.     

Electrochemical detection of DNA hybridization using biometallization

We demonstrate the amplified detection of a target DNA based on the enzymatic deposition of silver. In this method, the target DNA and a biotinylated detection DNA probe hybridize to a capture DNA probe tethered onto a gold electrode. Neutravidin-conjugated alkaline phosphatase binds to the biotin of the detection probe on the electrode surface and converts the nonelectroactive substrate of the enzyme, p-aminophenyl phosphate, into the reducing agent, p-aminophenol. The latter, in turn, reduces metal ions in solutions leading to deposition of the metal onto the electrode surface and DNA backbone. This process, which we term biometallization, leads to a great enhancement in signal due to the accumulation of metallic silver by a catalytically generated enzyme product and, thus, the electrochemical amplification of a biochemically amplified signal. The anodic stripping current of enzymatically deposited silver provides a measure of the extent of hybridization of the target oligomers. This biometallization process is highly sensitive, detecting as little as 100 aM (10 zmol) of DNA. We also successfully applied this method to the sequence-selective discrimination between perfectly matched and mismatched target oligonucleotides including a single-base mismatched target.     

Escherichia coli genosensor based on polyaniline

Avidin-modified polyaniline (PANI) electrochemically deposited onto a Pt disk electrode has been utilized for direct detection of Escherichia coli by immobilizing a 5'-biotin-labeled E. coli probe (BdE) using a differential pulse voltammetric technique in the presence of methylene blue as a DNA hybridization indicator. Depending on the target sample and the sonication time, this BdE-avidin-PANI bioelectrode can be utilized to electrochemically detect a complementary target probe (0.009 ng/microL), E. coli genomic DNA (0.01 ng/microL) and 11 E. coli cells/mL in 60 s to 14 min (hybridization time) without using PCR and can be used 5-7 times at temperatures of 30-45 degrees C.     

Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction

Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.     

Direct detection of DNA conformation in hybridization processes

DNA hybridization studies at surfaces normally rely on the detection of mass changes as a result of the addition of the complementary strand. In this work we propose a mass-independent sensing principle based on the quantitative monitoring of the conformation of the immobilized single-strand probe and of the final hybridized product. This is demonstrated by using a label-free acoustic technique, the quartz crystal microbalance (QCM-D), and oligonucleotides of specific sequences which, upon hybridization, result in DNAs of various shapes and sizes. Measurements of the acoustic ratio ΔD/ΔF in combination with a "discrete molecule binding" approach are used to confirm the formation of straight hybridized DNA molecules of specific lengths (21, 75, and 110 base pairs); acoustic results are also used to distinguish between single- and double-stranded molecules as well as between same-mass hybridized products with different shapes, i.e., straight or "Y-shaped". Issues such as the effect of mono- and divalent cations to hybridization and the mechanism of the process (nucleation, kinetics) when it happens on a surface are carefully considered. Finally, this new sensing principle is applied to single-nucleotide polymorphism detection: a DNA hairpin probe hybridized to the p53 target gene gave products of distinct geometrical features depending on the presence or absence of the SNP, both readily distinguishable. Our results suggest that DNA conformation probing with acoustic wave sensors is a much more improved detection method over the popular mass-related, on/off techniques offering higher flexibility in the design of solid-phase hybridization assays.