Electrochemical detection of single-nucleotide mismatches using an electrode microarray

Gold electrode arrays with electrode diameters of 10 mum were used for the detection of eight single-nucleotide mismatches in unlabeled and prehybridized DNA by electrochemical impedance spectroscopy (EIS). Because of the differences in the electrical properties of films of duplex DNA (normal duplex DNA in B-form) in the presence and absence of Zn(2+) at pH > or = 8.6, Randles equivalent circuits were employed to evaluate the EIS results. The difference in the charge-transfer resistance (DeltaR(CT)) between B-DNA (absence of Zn2+ at pH > or = 8.6) and M-DNA (presence of Zn2+ at pH > or = 8.6) allows unequivocal detection of all eight single-nucleotide mismatches within a 20-mer DNA sequence. After dehybridization/rehybridization with target DNA, DeltaR(CT) allows the discrimination of single-nucleotide mismatches with concentrations of the target strand as low as 10 fM. Although the presence of protein impurities (bovine serum albumin, 10 microg/mL) interferes with the detection of the target strand (1 pM detection limit), the presence of nontarget DNA (calf thymus DNA, 10(-8) M) does not interfere, and the detection limit for recognition of the target strand remains at 10 fM.     

Electrochemical detection of single-nucleotide mismatches: application of M-DNA

The detection of a single-nucleotide mismatch in unlabeled duplex DNA by electrochemical methods is presented. Impedance spectroscopy is used to characterize a perfect duplex monolayer and three DNA monolayers differing in the position of the mismatch. The monolayers were studied as B-DNA (normal duplex DNA) and after conversion to M-DNA (a metalated duplex). Modeling of the impedance data to an equivalent circuit provides parameters that are useful in discriminating the four monolayer configurations. The resistance to charge transfer, R(CT), was lower for all duplexes after conversion to M-DNA. Contrary to expectations, R(CT) was also found to decrease for duplexes containing a mismatch. However, R(CT) was found to be diagnostic for mismatch detection. In particular, the difference in R(CT) between B- and M-DNA (deltaR(CT)) decreased from 190(22) omega.cm(2) for a perfectly matched duplex to 95(20), 30(20), and 85(20) omega.cm(2) for a mismatch at the top (distal), middle, and bottom (proximal) positions of the monolayer with respect to the gold surface. Further, a method to form loosely packed single-stranded (ss)-DNA monolayers by duplex dehybridization that is able to rehybridize to target strands is presented. Rehybridization efficiencies were in the range of 40-70%. Under incomplete hybridization conditions, the R(CT) was the same for matched and mismatched duplexes under B-DNA conditions. However, deltaR(CT) between B- and M-DNA, under incomplete hybridization, still provided a distinction. The deltaR(CT) for a perfect duplex was 76(12) omega.cm(2), whereas a mismatch in the middle of the sequence yielded a deltaR(CT) value of 30(15) omega.cm(2). The detection limit was measured and the impedance methodology reliably detected single DNA base pair mismatches at concentrations as low as 100 pM.     

Conformational switching immobilized hairpin DNA probes following subsequent expanding of gold nanoparticles enables visual detecting sequence-specific DNA

A simple, rapid, and sensitive method for visual detection of sequence-specific DNA was developed using hairpin DNA as the recognition element and hydroxylamine-enlarged gold nanoparticles (Au-NPs) as the signal producing component. In the assay, we employed a hairpin DNA probe dually labeled with amine and biotin at the 5'- and 3'-end, respectively. The probe was coupled with reactive N-oxysuccinnimide in a DNA-bind 96-well plate. Without the target DNA, the immobilized hairpin probe was in a "closed" state, which kept the streptavidin-gold off the biotin. The hybridization between the loop sequence and the target broke the short stem duplex upon approaching the target DNA. Consequently, biotin was forced away from the 96-well plate surface and available for conjugation with the streptavidin-gold. The hybridization could be detected visually after the HAuCl(4)-NH(2)OH redox reaction catalyzed by the Au-NPs. Under the optimized conditions, the visual DNA sensor could detect as low as 100 amol of DNA targets with excellent differentiation ability and even a single-base mismatch.     

Selective and homogeneous fluorescent DNA detection by target-induced strand displacement using cationic conjugated polyelectrolytes

A new methodology has been developed for DNA detection that interfaces optical amplification properties of cationic conjugated polyelectrolytes with highly selective target-induced DNA strand displacement. The probe solution contains a cationic conjugated polyelectrolyte (CCP-1), partly hybridized duplex DNA labeled with a fluorescein at the 5'-terminus, and endonuclease Hae III. Excitation of the CCP-1 leads to efficient energy transfer from CCP-1 to fluorescein. In the presence of a complementary DNA strand to one strand of the probe duplex, a hairpin DNA with the recognition site of endonuclease Hae at the double-stranded stem is released following its cleavage by Hae III to generate short DNA fragment carrying fluorescein. The relatively weak electrostatic interactions between the DNA fragment and CCP-1 lead fluorescein far away from CCP-1 and inefficient energy transfer between them is present. Thus, the DNA can be detected by fluorescence spectra in view of the observed CCP-1 or fluorescein emission changes in aqueous solutions. To avoid utilizing unstable Hae III endonuclease, a new system based on RNA-cleaving DNAzyme was further developed. The protocol offers a convenient approach for homogeneous, selective, and sensitive DNA assay in aqueous solution without using any denaturation steps. Compared with previously reported DNA sensors based on conjugated polyelectrolytes, our new method is highly sequence specific and a single-nucleotide mismatch can be clearly detected in target DNA.     

Structure-function relationships of three kinds of immobilized DNA probes in the discrimination abilities of single nucleotide variation

We have compared here the nucleic acid hybridization abilities of three kinds of immobilized probes with different structures. Under the conventional structural design, we found that the share-stem hairpin structure probe (SHP) was more easily hybridized with the target than the linear probe and conventional hairpin shaped probe (HP). The HP probe had the lowest hybridization ability. However, it was shown a contrary result in the single-nucleotide mismatch discrimination ratio. Subsequently, we increased the Tm of the two hairpin-shaped probes and found both of the two probes were improved on the hybridization specificities even though the hybridization abilities were decreased. The result of the hybridization temperature optimization experiment showed that at 45 degrees C, the Dr Ratio (mismatch discrimination ratio) of HP-28T and SHP-32T were both as high as 8.5 while the ratios of linear probe were -0.3-0.7. The results suggested that the immobilized shared stem hairpin shaped probes also had the ability to discriminate single-nucleotide variation under proper design.     

"Off-On" Electrochemical Hairpin-DNA-Based Genosensor for Cancer Diagnostics

A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.     

Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction

Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.     

DNA electrochemical sensor based on conducting polymer: dependence of the "signal-on" detection on the probe sequence localization

We show in this work that it is possible to make selective direct electrochemical hybridization detection of a target strand onto a probe strand immobilized on a conducting polymer modified with a quinone group, which presents cation-exchange properties. This leads to a "signal-on"detection, a unique behavior in comparison to similar systems described in the literature. It is shown that this system is efficient for various probe and target lengths (10-30 bp) and can discriminate a single mismatch. To go further in comprehension of the detection mechanism, a systematic study of the electrochemical response versus the probe sequence localization onto the immobilized strand is performed. For example, a 30-bp target strand is divided into three shorter 10-bp sequences (A-C, respectively), and we investigate the successive hybridization of these 1/3 strands onto the 30-bp probe strand. It is shown that one probe strand can be used to address several shorter targets.     

Direct detection of DNA conformation in hybridization processes

DNA hybridization studies at surfaces normally rely on the detection of mass changes as a result of the addition of the complementary strand. In this work we propose a mass-independent sensing principle based on the quantitative monitoring of the conformation of the immobilized single-strand probe and of the final hybridized product. This is demonstrated by using a label-free acoustic technique, the quartz crystal microbalance (QCM-D), and oligonucleotides of specific sequences which, upon hybridization, result in DNAs of various shapes and sizes. Measurements of the acoustic ratio ΔD/ΔF in combination with a "discrete molecule binding" approach are used to confirm the formation of straight hybridized DNA molecules of specific lengths (21, 75, and 110 base pairs); acoustic results are also used to distinguish between single- and double-stranded molecules as well as between same-mass hybridized products with different shapes, i.e., straight or "Y-shaped". Issues such as the effect of mono- and divalent cations to hybridization and the mechanism of the process (nucleation, kinetics) when it happens on a surface are carefully considered. Finally, this new sensing principle is applied to single-nucleotide polymorphism detection: a DNA hairpin probe hybridized to the p53 target gene gave products of distinct geometrical features depending on the presence or absence of the SNP, both readily distinguishable. Our results suggest that DNA conformation probing with acoustic wave sensors is a much more improved detection method over the popular mass-related, on/off techniques offering higher flexibility in the design of solid-phase hybridization assays.     

Cationic comb-type copolymers for DNA analysis

Genetic diagnoses, such as single nucleotide polymorphism (SNP) typing, allow elucidation of gene-based physiological differences, such as susceptibility to diseases and response to drugs, among individuals. Many detection technologies, including allele-specific hybridization, allele-specific primer extension and oligonucleotide ligation, are being used to discriminate SNP alleles. These methods still have many unsolved practical issues. In general they require adequate and specific hybridizations of primer or probe DNAs with target DNAs. This frequently needs optimization of the probe/primer structures and operating conditions. In nature, highly homology-sensitive hybridization is assisted by a nucleic acid chaperone that reduces the energy barrier associated with breakage and reassociation of nucleic base pairs. Here we report a simple, quick, precise but enzyme-free method for SNP analysis. The method uses cationic comb-type copolymers (CCCs) producing high nucleic acid chaperone activities. A single-base mismatch in 20-mer DNA can be detected within a few minutes at ambient temperatures (25-37 degrees C). Even without careful optimization processes, the method has the sensitivity to detect the mismatches causing subtle changes (Delta T(m) equals approximately 1 degree C) in duplex thermal stability. CCCs may have various bioanalytical applications where precise hybridization of nucleic acids is needed.     

Sensitive Detection of MicroRNAs with Hairpin Probe-Based Circular Exponential Amplification Assay

MicroRNAs (miRNAs) play important regulatory roles in a wide range of biological processes, and their aberrant expression is associated with cancer development and a variety of diseases. Here, we develop a simple, sensitive, and specific miRNA assay on the basis of circular exponential amplification in combination with the hairpin probes. The binding of target miRNA with a linear DNA template initiates the first strand displacement amplification (SDA) and generates the universal triggers which are complementary to the 3' protruding end of a hairpin probe. These universal triggers function not only as the primers to unfold the hairpin probes through an extension reaction, generating distinct fluorescence signals, but also as the amplification templates to initiate the second SDA reaction. Moreover, the second SDA reaction can release new triggers to initiate the above two consecutive SDA reactions, thus constituting a circular exponential amplification which enables the conversion of a small amount of miRNAs to a large number of universal triggers to unfold abundant hairpin probes. This hairpin probe-based circular exponential amplification assay exhibits high sensitivity with a detection limit of 3.80 × 10(-13) M and a detection range of 4 orders of magnitude. It can even discriminate single-nucleotide difference between miRNA family members and perform well in real sample analysis. Notably, in this assay, the long-stem hairpin probes are unfolded through an extension reaction rather than through a conventional hybridization reaction controlled by the thermodynamic equilibrium in the case of molecular beacons, making the design of hairpin probes very simple. This hairpin probe-based circular exponential amplification assay holds a great promise for further application in biomedical research and early clinical diagnosis.     

Cantilever-based optical deflection assay for discrimination of DNA single-nucleotide mismatches

Characterization of single-nucleotide polymorphisms is a major focus of current genomics research. We demonstrate the discrimination of DNA mismatches using an elegantly simple microcantilever-based optical deflection assay, without the need for external labeling. Gold-coated silicon AFM cantilevers were functionalized with thiolated 20- or 25-mer probe DNA oligonucleotides and exposed to target oligonucleotides of varying sequence in static and flow conditions. Hybridization of 10-mer complementary target oligonucleotides resulted in net positive deflection, while hybridization with targets containing one or two internal mismatches resulted in net negative deflection. Mismatched targets produced a stable and measurable signal when only a four-base pair stretch was complementary to the probe sequence. This technique is readily adaptable to a high-throughput array format and provides a distinct positive/negative signal for easy interpretation of oligonucleotide hybridization.     

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.     

Electrochemical biosensor for detection of BCR/ABL fusion gene using locked nucleic acids on 4-aminobenzenesulfonic acid-modified glassy carbon electrode

In this study, an electrochemical DNA biosensor was developed for detection of the breakpoint cluster region gene and the cellular abl (BCR/ABL) fusion gene in chronic myelogenous leukemia by using 18-mer locked, nucleic acid-modified, single-stranded DNA as the capture probe. The capture probe was covalently attached on the sulfonic-terminated aminobenzenesulfonic acid monolayer-modified glassy carbon electrode through the free amines of DNA bases based on the acyl chloride cross-linking reaction. The covalently immobilized capture probe could selectively hybridize with its target DNA to form double-stranded DNA (dsDNA) on the LNA/4-ABSA/GCE surface. Differential pulse voltammetry was used to monitor the hybridization reaction on the capture probe electrode. The decrease of the peak current of methylene blue, an electroactive indicator, was observed upon hybridization of the probe with the target DNA. The results indicated that, in pH 7.0 Tris-HCl buffer solution, the peak current was linear with the concentration of complementary strand in the range of 1.0 x 10 (-12)1.1 x 10 (-11) M with a detection limit of 9.4 x 10 (-13) M. This new method demonstrates its excellent specificity for single-base mismatch and complementary dsDNA after hybridization, and this probe has been used for assay of PCR real sample with satisfactory results.     

Electrochemical characterization of deoxyribonucleic acid on aluminum(III)/poly(l-glutamic acid) film and its application for the detection of phosphinothricin acetyltransferase gene-specific sequence

A simple strategy of transgenic sequence-specific detection without a special amplification procedure was developed on the basis of aluminum(III)/poly(l-glutamic acid) (PLGA) film. An aluminum ion (Al(III)) thin film was assembled on the surface of PLGA via the electrostatic binding of Al(III) with carboxyl, namely Al(III)/PLGA. The immobilization of deoxyribonucleic acid (DNA) was carried out on this Al(III)/PLGA film by Al(III)-single strand DNA (ssDNA) interaction. Surface hybridization between the immobilized ssDNA and its complementary ssDNA was monitored by electrochemical impedance spectroscopy (EIS) using [Fe(CN)₆]^3−/4− as a redox probe. Under the optimal conditions, this DNA electrochemical sensor was applied to determine the specific gene sequence related to phosphinothricin acetyltransferase transgene (PAT) in the transgenic plants by label-free EIS.     

Dual-stage DNA sensing: recognition and detection

Selective polynucleotide recognition and detection based on a dual-stage method are described. The method involves the development of a recognition surface based on gold nanoparticles modified with a thiolated capture probe able to hybridize with its complementary sequence (target). After hybridization, this sensing surface is removed from the solution and electrodeposited on an electrode surface. The detection of the hybridization event is achieved using the complex [Ru(NH(3))(5)L](2+), were L is [3-(2-phenanthren-9-yl-vinyl)-pyridine], as electrochemical indicator. This complex binds to double strand DNA more efficiently than to single stranded DNA. The advantage of this dual-stage DNA sensing method is the high selectivity derived from the separation of the hybridization event (occurring on one surface) from the detection step (on a different surface), enabling the analysis of long target DNAs, which is usually the case in real DNA sequence analysis. In addition, this approach not only quantifies pmol of a complementary target sequence but also is sensitive to the presence of a single mismatch and its position in the sequence.     

General colorimetric detection of proteins and small molecules based on cyclic enzymatic signal amplification and hairpin aptamer probe

In this work, we developed a simple and general method for highly sensitive detection of proteins and small molecules based on cyclic enzymatic signal amplification (CESA) and hairpin aptamer probe. Our detection system consists of a hairpin aptamer probe, a linker DNA, two sets of DNA-modified AuNPs, and nicking endonuclease (NEase). In the absence of a target, the hairpin aptamer probe and linker DNA can stably coexist in solution. Then, the linker DNA can assemble two sets of DNA-modified AuNPs, inducing the aggregation of AuNPs. However, in the presence of a target, the hairpin structure of aptamer probe is opened upon interaction with the target to form an aptamer probe-target complex. Then, the probe-target complex can hybridize to the linker DNA. Upon formation of the duplex, the NEase recognizes specific nucleotide sequence and cleaves the linker DNA into two fragments. After nicking, the released probe-target complex can hybridize with another intact linker DNA and the cycle starts anew. The cleaved fragments of linker DNA are not able to assemble two sets of DNA-modified AuNPs, thus a red color of separated AuNPs can be observed. Taking advantage of the AuNPs-based sensing technique, we are able to assay the target simply by UV-vis spectroscopy and even by the naked eye. Herein, we can detect the human thrombin with a detection limit of 50 pM and adenosine triphosphate (ATP) with a detection limit of 100 nM by the naked eye. This sensitivity is about 3 orders of magnitude higher than that of traditional AuNPs-based methods without amplification. In addition, this method is general since there is no requirement of the NEase recognition site in the aptamer sequence. Furthermore, we proved that the proposed method is capable of detecting the target in complicated biological samples.     

Sensitive and homogeneous protein detection based on target-triggered aptamer hairpin switch and nicking enzyme assisted fluorescence signal amplification

Specific and sensitive detection of proteins in biotechnological applications and medical diagnostics is one of the most important goals for the scientific community. In this study, a new protein assay is developed on the basis of hairpin probe and nicking enzyme assisted signal amplification strategy. The metastable state hairpin probe with short loop and long stem is designed to contain a protein aptamer for target recognition. A short Black Hole Quencher (BHQ)-quenching fluorescence DNA probe (BQF probe) carrying the recognition sequence and cleavage site for the nicking enzyme is employed for fluorescence detection. Introduction of target protein into the assay leads to the formation change of hairpin probe from hairpin shape to open form, thus faciliating the hybridization between the hairpin probe and BQF probe. The fluorescence signal is amplified through continuous enzyme cleavage. Thrombin is used as model analyte in the current proof-of-concept experiments. This method can detect thrombin specifically with a detection limit as low as 100 pM. Additionally, the proposed protein detection strategy can achieve separation-free measurement, thus eliminating the washing steps. Moreover, it is potentially universal because hairpin probe can be easily designed for other proteins by changing the corresponding aptamer sequence.     

Electrogenerated chemiluminescence DNA biosensor based on hairpin DNA probe labeled with ruthenium complex

A highly selective electrogenerated chemiluminescence (ECL) biosensor for the detection of target single-strand DNA (ss-DNA) was developed using hairpin DNA as the recognition element and ruthenium complex as the signal-producing compound. The ECL-based DNA biosensor was fabricated by self-assembling the ECL probe of thiolated hairpin DNA tagged with ruthenium complex on the surface of a gold electrode. In the absence of target ss-DNA, the ECL probe immobilized on the surface of the electrode was in the folded configuration in which its termini were held in close proximity to the electrode, and thus a strong ECL signal could be generated. In the presence of target ss-DNA, a stem-loop of the ECL probe on the electrode was converted into a linear double-helix configuration due to hybridization, resulting in the tag moving away from the electrode surface, which in turn decreased the ECL signal. The ECL intensity of the DNA biosensor generated a "switch off" mode, which decreased with an increase of the concentration of target DNA, and a detection limit of 9 x 10(-11) M complementary target ss-DNA was achieved. Single mismatched target ss-DNA was effectively discriminated from complementary target ss-DNA. The effect of different loop lengths of the hairpin DNA on the selectivity of the ECL DNA biosensor has been investigated. This work demonstrated that the sensitivity and specificity of an ECL DNA biosensor could be greatly improved using a hairpin DNA species which has an appropriate stem and loop length as the recognition element.     

Open bridge-structured gold nanoparticle array for label-free DNA detection

We focused on changes in the electrical property of the open bridge-structured gold nanoparticles array consisting of 46-nm parent and 12-nm son gold nanoparticles by hybridization and applied it for a simple electrical DNA detection. Since a target DNA of a 24-mer oligonucleotide was added to the probe DNA modified 12-nm Au nanoparticles, which was arranged on the gap between the 46-nm Au particles, the response was read by an electrical readout system. Even in a simple measuring method, we obtained a rapid response to the cDNA with a high S/N ratio of 30 over a wide concentration range and a detection limit of 5.0 fmol. Moreover, the array discriminated 1-base mismatches, regardless of their location in the DNA sequence, which enabled us to detect single-nucleotide polymorphism, which is one of the important diagnoses, without any polymerase chain reaction amplification, sophisticated instrumentation, or fluorescent labeling through an easy-to-handle electrical readout system.