Defensins are mitogenic for epithelial cells and fibroblasts

Defensins are a family of structurally homologous peptides contained within phagocytic cells. Although these peptides are best known for their broad spectrum antimicrobial properties, they also inhibit ACTH (corticotropin) stimulated corticosterone production, chemoattract monocytes, and lyse mammalian cells. We now report that these peptides are potent mitogens in vitro in the same concentration range that they display potent antimicrobial activity in vitro. These concentrations are in the same range as those expected to be present in vivo during the wound healing process. All defensins tested were stimulatory for epithelial cells and fibroblasts and acted synergistically with insulin. These are the first data to disclose the strong growth-promoting effects of this unique family of peptides and point to another basic mechanism whereby the macrophage and neutrophil may participate in a variety of trophic, physiologic, and pathologic processes.     

Intraaortic hemopoietic cells are derived from endothelial cells during ontogeny

We have investigated the developmental relationship of the hemopoietic and endothelial lineages in the floor of the chicken aorta, a site of hemopoietic progenitor emergence in the embryo proper. We show that, prior to the onset of hemopoiesis, the aortic endothelium uniformly expresses the endothelium-specific membrane receptor VEGF-R2. The onset of hemopoiesis can be determined by detecting the common leukocyte antigen CD45. VEGF-R2 and CD45 are expressed in complementary fashion, namely the hemopoietic cluster-bearing floor of the aorta is CD45(+)/VEGF-R2(-), while the rest of the aortic endothelium is CD45(-)/VEGF-R2(+). To determine if the hemopoietic clusters are derived from endothelial cells, we tagged the E2 endothelial tree from the inside with low-density lipoproteins (LDL) coupled to DiI. 24 hours later, hemopoietic clusters were labelled by LDL. Since no CD45(+) cells were inserted among endothelial cells at the time of vascular labelling, hemopoietic clusters must be concluded to derive from precursors with an endothelial phenotype.     

Glial-restricted precursors are derived from multipotent neuroepithelial stem cells

Neuroepithelial cells in the developing ventricular zone differentiate into neurons, astrocytes, and oligodendrocytes. It is not known, however, whether this differentiation occurs in a single step or is a pathway utilizing intermediate more restricted precursor cells. To characterize the generation of glial cells from multipotent stem cells we have cultured neuroepithelial (NEP) cells from E10.5 rat embryos. Cultured NEP cells do not express any glial differentiation markers when grown on fibronectin/laminin under nondifferentiation conditions. NEP cells, however, differentiate into A2B5 immunoreactive cells which can subsequently give rise to oligodendrocytes and astrocytes. Clonal analysis of NEP cells demonstrates that the A2B5 immunoreactive cells arise in clones that contain neurons and astrocytes, indicating that A2B5(+) cells arise from multipotent NEP precursor cells. A2B5(+) cells, maintained as undifferentiated cells over multiple passages, can subsequently give rise to both oligodendrocytes and astrocytes. A2B5(+) cells, however, do not generate neurons. Thus A2B5(+) cells represent a restricted progenitor cell population that differentiates from a multipotent NEP cell. Based on our results we propose that differentiation of the multipotential NEP cells to terminally differentiated glial cells occurs via intermediate restricted precursors.     

Structural identification of a major mitogenic lipid derived from Bacillus subtilis as a glycerophosphoglycolipid

Lipids extracted from Bacillus subtilis using a 2:1 mixture of chloroform and methanol have been found to be very mitogenic. These lipids were fractionated on a silica column and eluted with chloroform, acetone, and 60% methanol in chloroform, and the mitogenic activity was recovered in the last fraction. Further purification of the mitogenic components was achieved by HPLC on an amino-isopropyl bonded-phase column using a linear gradient of 5-20 mM ammonium acetate in a mobile phase consisting of hexane, 2-propanol, methanol, and water (5.5:8:1.5:1). Two major and several minor mitogenic peaks were observed. One major mitogenic lipid was isolated in pure form and structurally characterized by chemical degradation analysis, NMR spectroscopy, and mass spectrometry. Mild acid hydrolysis of the lipid released glycerol phosphate and a neutral glycolipid. Saponification of the lipid released a water-soluble head group and C14-C17 branched fatty acids. Total acid hydrolysis of the head group revealed the presence of glycerol and glucose in a ratio of 1:1. Mild acid hydrolysis of the head group to remove the glycerol phosphate produced a neutral partial head group. The partial head group was methylated and then analyzed by GLC-CIMS and by the reductive-cleavage method, which revealed that it was composed of nonreducing terminal glucopyranosyl, 6-linked glucopyranosyl, and 3-linked glycerol residues in equimolar proportions. Finally, the molecular weight of the permethylated head group, obtained by fast atom bombardment mass spectrometry, was 724.3340, which is consistent with the composition of two glucose residues, one glycerol residue, and one glycerol phosphate residue. On the basis of all these results, the intact mitogenic lipid was identified as 1,2-di-O-acyl-3-O-[6-(sn-glycerol-phospho)-beta-D-glucopyranosyl-(1-->6) - beta-D-glucopyranosyl]glycerol. The purified glycolipid possessed very potent mitogenic activity in a murine splenocyte proliferation assay at a concentration of 0.01-0.1 microgram/mL.     

Properties of a heparin-binding peptide derived from bovine lactoferrin

A heparin-binding peptide was isolated from a proteolytic hydrolysate of bovine lactoferrin by affinity chromatography using an immobilized heparin column. Analysis of amino acid sequences at the N-terminus showed that this heparin-binding peptide is derived from the region beginning at the 17th amino acid residue of the bovine lactoferrin sequence. The molecular mass of this peptide was 3195.5 as measured by matrix-assisted laser desorption-time of flight mass spectrometry. This peptide is the same as the bactericidal peptide lactoferricin B. In an aqueous environment, this peptide displays mainly a beta-sheet structure and an unordered structure as assessed by measurements of circular dichroism spectra. When this peptide was mixed with heparin, a distinct spectral change was induced because of conformational alteration of the peptide. This spectral change was reversible. Analysis of data from peptide synthesis indicated that binding by the sequence Arg28-Met29-Lys30-Lys31 of bovine lactoferrin is significant and that there is a synergistic contribution from Lys18-Cys19-Arg20-Arg21, and Arg38-Arg39.     

CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry

Isolated murine splenic B cells undergo spontaneous apoptosis. Motifs containing unmethylated CpG dinucleotides in bacterial DNA or in synthetic oligodeoxynucleotides (ODN) are known to activate murine B cells. Now we show that ODN that induce spleen B cell cycle entry also inhibit spontaneous apoptosis in a sequence-specific fashion. Reversal of the CG to GC abolished activity. Methylation of the central cytosine decreased activity. When CpG is preceded by a cytosine or followed by a guanine, activity was abolished. Other substitutions at the same positions had no effect. Dose-response curves for apoptosis protection and G1 entry suggested that a uniform population of ODN recognition sites controlled downstream ODN effects. A CpG ODN with a nuclease-resistant phosphorothioate backbone (S-ODN) was also active, and increased the levels of c-myc, egr-1, c-jun, bclXL, and bax mRNA and c-Myc, c-Jun, Bax, and BclXL protein in spleen B cells. Levels of c-myb, myn, c-Ki-ras, and bcl2 mRNA remained unchanged. When protein synthesis was inhibited, at 16 h ODN-induced cell cycle entry was abolished and apoptosis protection was partially preserved. Under these conditions, c-Myc was still present, but c-Jun and BclXL were not detected. Our results suggest that CpG containing ODN motifs provide signals for both survival and cell cycle entry. Single base changes determine whether this signal proceeds through a rate-limiting step governing at least two steps in apoptosis (plasma membrane transition, DNA cleavage) and two phases of the cell cycle (G1 and S phase entry). This biologic action is associated with increased c-Myc, c-Jun, and BclXL expression.     

T cells from children with IDDM are sensitized to bovine serum albumin

Epidemiological and experimental evidence suggested that denial of dietary cow milk protein early in life protects genetically susceptible children and animals from insulin-dependent diabetes (IDDM). Bovine serum albumin (BSA) was proposed as a candidate milk-borne mimicry antigen responsible for the diabetogenic cow milk effect. Elevated anti-BSA antibodies have been observed in patients and diabetic rodents, and these antibodies precipitate p69 from islet cell lysates. IDDM is a T cell mediated disorder but efforts to detect BSA-specific T cells in diabetic children have so far failed. We describe here a culture system which allowed the detection of BSA-specific T cells and we mapped this response to the ABBOS peptide (pre-BSA position 152-169) previously identified as a possible mimicry epitope. ABBOS-sensitized T cells were found in 28/31 children with recent onset IDDM but not in non-diabetic controls nor in children with SLE or JRA. T cell proliferative responses declined within the first few years of diabetes diagnosis. Although no effector cell role for BSA/ABBOS specific T lymphocytes has been demonstrated, the presence of BSA peptide-specific T cells strengthens the postulated link between a cow milk protein and IDDM.     

Restriction fragment length polymorphism and spacer oligonucleotide typing: a comparative analysis of fingerprinting strategies for Mycobacterium bovis

The combination of conventional investigation and DNA fingerprinting is yielding important insights into the epidemiology of Mycobacterium bovis infections. Various genetic markers used in restriction fragment length polymorphism (RFLP) have recently been exploited for fingerprinting of M. bovis isolates. The newly developed spacer oligonucleotide typing aimed to investigate the polymorphism of M. tuberculosis in the DR locus, has also been applied to the molecular typing of M. bovis isolates. This work compared the performance of the insertion sequence (IS) IS6110, IS1081 and the genetic elements polymorphic G + C-rich repeat (PGRS) and direct repeat (DR) used in RFLP analysis with spoligotyping using a group of 128 Spanish M. bovis isolates. In this study, the most sensitive technique for identifying polymorphism in M. bovis was PGRS-RFLP, closely followed by IS6110-RFLP. We propose several schemes for fingerprinting of these isolates, however, the clear geographical variations found by different authors makes the study of each local situation indispensable. An international consensus in the methods used would be desirable for efficient interlaboratory comparison of strains.     

An ultrastructural study of heterokaryons derived from Theileria parva-infected bovine lymphoblasts and Ehrlich ascites tumour cells

An ultrastructural study was made of Sendai virus induced heterokaryons derived from Theileria parva-infected lymphoblasts and Ehrlich ascites tumour cells. When fusion occurred, parasites were successfully integrated into the cytoplasm of the resulting heterokaryons where they appeared as morphologically normal macroschizonts. Homokaryon formation was also noted. This occurred frequently between Ehrlich ascites tumour cells and rarely with lymphoblasts. A small proportion of heterokaryons contained altered forms of T parva showing nuclear components, vesicular structures and paired organelles similar to the microshizont stage of the parasite.     

Minisequencing: a specific tool for DNA analysis and diagnostics on oligonucleotide arrays

We describe a method for multiplex detection of mutations in which the solid-phase minisequencing principle is applied to an oligonucleotide array format. The mutations are detected by extending immobilized primers that anneal to their template sequences immediately adjacent to the mutant nucleotide positions with single labeled dideoxynucleoside triphosphates using a DNA polymerase. The arrays were prepared by coupling one primer per mutation to be detected on a small glass area. Genomic fragments spanning nine disease mutations, which were selected as targets for the assay, were amplified in multiplex PCR reactions and used as templates for the minisequencing reactions on the primer array. The genotypes of homozygous and heterozygous genomic DNA samples were unequivocally defined at each analyzed nucleotide position by the highly specific primer extension reaction. In a comparison to hybridization with immobilized allele-specific probes in the same assay format, the power of discrimination between homozygous and heterozygous genotypes was one order of magnitude higher using the minisequencing method. Therefore, single-nucleotide primer extension is a promising principle for future high-throughput mutation detection and genotyping using high density DNA-chip technology.     

A differential diagnostic criterion for Babesia major and Babesia bigemina vermicules from tick haemolymph

Babesia major mature and immature vermicules in the haemolymph of Haemaphysalis punctata were measured and found to be significantly larger than vermicules of Babesia bigemina. Mature B. major vermicules had a mean length of 15.53 micrometer and mature B. bigemina vermicules had a mean length of 11.79 micrometer. This difference provides a new criterion for the differentiation of the two species.     

CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODN) cause B cell proliferation and Ig secretion, monocyte cytokine secretion, and activation of NK cell lytic activity and IFN-gamma secretion in vivo and in vitro. The potent immune activation by CpG ODN suggests possible utility for enhancing immune responses to vaccines. Mice immunized with recombinant hepatitis B virus surface Ag and a CpG ODN as an immune enhancer have titers of Abs against HBsAg (anti-HBs) that are five times higher than those of mice immunized with HBsAg and the standard adjuvant, aluminum hydroxide (alum). Ab titers in mice immunized with HBsAg and both CpG ODN plus alum were 35 times higher than the titers in mice immunized with alum alone, indicating a strong synergistic interaction between the CpG ODN and alum. ODN without CpG motifs had little or no immune-enhancing activity at the doses used herein. Alum induces a Th2 humoral response (mostly IgG1) and no CTL. In contrast, CpG ODN gives a strong Thl response with predominantly IgG2a Abs and CTL, even when mixed with alum. In vitro studies to determine possible mechanisms of CpG immune-enhancing effects show that CpG ODN induce expression of costimulatory molecules on Ag-presenting cells and drive B cell isotype switching in the appropriate cytokine milieu. These studies demonstrate that CpG ODN are promising new immune enhancers for vaccination applications.     

Shc and Enigma are both required for mitogenic signaling by Ret/ptc2

Ret/ptc2 is a constitutively active, oncogenic form of the c-Ret receptor tyrosine kinase. Like the other papillary thyroid carcinoma forms of Ret, Ret/ptc2 is activated through fusion of the Ret tyrosine kinase domain to the dimerization domain of another protein. Investigation of requirements for Ret/ptc2 mitogenic activity, using coexpression with dominant negative forms of Ras and Raf, indicated that these proteins are required for mitogenic signaling by Ret/ptc2. Because activation of Ras requires recruitment of Grb2 and SOS to the plasma membrane, the subcellular distribution of Ret/ptc2 was investigated, and it was found to localize to the cell periphery. This localization was mediated by association with Enigma via the Ret/ptc2 sequence containing tyrosine 586. Because Shc interacts with MEN2 forms of Ret, and because phosphorylation of Shc results in Grb2 recruitment and subsequent signaling through Ras and Raf, the potential interaction between Ret/ptc2 and Shc was investigated. The PTB domain of Shc also interacted with Ret/ptc2 at tyrosine 586, and this association resulted in tyrosine phosphorylation of Shc. Coexpression of chimeric proteins demonstrated that mitogenic signaling from Ret/ptc2 required both recruitment of Shc and subcellular localization by Enigma. Because Shc and Enigma interact with the same site on a Ret/ptc2 monomer, dimerization of Ret/ptc2 allows assembly of molecular complexes that are properly localized via Enigma and transmit mitogenic signals via Shc.     

CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.     

Human bone marrow-derived mitogenic stimulation selective for breast carcinoma and neuroblastoma cells

In patients with neuroblastoma (NB) or breast carcinoma (BC), metastatic disease in the bone marrow (BM) is observed more frequently than at any other site, and a high incidence of BM metastases in these patients is associated with advanced disease and poor prognosis. These observations suggest the presence of BM micro-environmental elements that are favorable for NB and BC tumor cell growth. The influence of normal human BM cell-derived conditioned medium (CM) on clonogenic growth of BC and NB cell lines was investigated in vitro. The effects obtained were compared with those on tumor cells with a lower potential for BM metastasis. CM from unstimulated cultures of normal, healthy, low-density BM cells reproducibly and markedly augmented clonogenic growth of 3 BC and 3 NB cell lines. In contrast, growth of cell lines established from human tumors with differing metastatic propensity was unaffected by BM CM. Initial characterization, using crude BM CM, indicated that mitogenic activity (i) is mediated by peptides released by the non-adherent fraction of low-density BM cells and (ii) is not abolished by neutralizing antibodies against various cytokines known to be produced by BM cells and to regulate hematopoietic cell growth. Our observations suggest that certain specific peptides in the BM micro-environment may be responsible for the preferential growth of NB and BC metastases in BM.     

CpG DNA is a potent enhancer of systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice

Mucosal immunity is difficult to induce with subunit vaccines unless such vaccines are administered with a mucosal adjuvant such as cholera toxin (CT); however, CT is toxic in humans. Synthetic oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG) are potent adjuvants for the induction of Th1-like systemic immune responses against parenterally delivered proteins. Here, we show in mice that intranasal delivery of hepatitis B surface Ag, which alone has no effect, elicits good immune responses when given with CpG oligodeoxynucleotides and/or CT. Overall, CpG is superior to CT for the induction of humoral and cell-mediated systemic immunity as well as mucosal immune responses (IgA) at local (lung) and distant (feces) sites. Furthermore, CpG and CT act synergistically, giving stronger responses than those observed with 10 times more of either adjuvant alone. Ab isotypes were predominantly IgG1 (Th2-like) with CT, mixed IgG1/IgG2a (Th0) with CpG, and predominantly IgG2a (Th1-like) with CpG and CT together.     

Viable offspring derived from fetal and adult mammalian cells

Fertilization of mammalian eggs is followed by successive cell divisions and progressive differentiation, first into the early embryo and subsequently into all of the cell types that make up the adult animal. Transfer of a single nucleus at a specific stage of development, to an enucleated unfertilized egg, provided an opportunity to investigate whether cellular differentiation to that stage involved irreversible genetic modification. The first offspring to develop from a differentiated cell were born after nuclear transfer from an embryo-derived cell line that had been induced to become quiescent. Using the same procedure, we now report the birth of live lambs from three new cell populations established from adult mammary gland, fetus and embryo. The fact that a lamb was derived from an adult cell confirms that differentiation of that cell did not involve the irreversible modification of genetic material required for development to term. The birth of lambs from differentiated fetal and adult cells also reinforces previous speculation that by inducing donor cells to become quiescent it will be possible to obtain normal development from a wide variety of differentiated cells.     

Comparison of C18-carboxypropylbetaine and glass bead DNA extraction methods for detection of Mycobacterium bovis in bovine milk samples and analysis of samples by PCR

The purpose of this prospective study was to compare two different milk preparation methods to assay for the presence of Mycobacterium bovis by PCR. Detection by a C18-carboxypropylbetaine (CB-18)-based sample processing method was compared to extraction of DNA from milk with glass beads. Samples from 17 skin test-positive cattle were analyzed. Following CB-18 processing and glass bead extraction, the sensitivity of IS6110-based PCR was 94.1 and 58.8%, respectively (P < 0.025). Because CB-18 processing will permit the proficient use of PCR for diagnosis and surveillance of bovine tuberculosis, it will contribute to the more efficient detection and control of tuberculosis.