Characterization of an epithelial approximately 460-kDa protein that facilitates endocytosis of intrinsic factor-vitamin B12 and binds receptor-associated protein

By using receptor-associated protein (RAP) as an affinity target, an intrinsic factor-vitamin B12 (IF-B12)-binding renal epithelial protein of approximately 460 kDa was copurified together with the transcobalamin-B12-binding 600-kDa receptor, megalin. IF-B12 affinity chromatography of renal cortex membrane from rabbit and man yielded the same approximately 460-kDa protein. Binding studies including surface plasmon resonance analyses of the protein demonstrated a calcium-dependent and high affinity binding of IF-B12 to a site distinct from the RAP binding site. The high affinity binding of IF-B12 was dependent on complex formation with vitamin B12. Light and electron microscope autoradiography of rat renal cortex cryosections incubated directly with IF-57Co-B12 and rat proximal tubules microinjected in vivo with the radioligand demonstrated binding of the ligand to endocytic invaginations of proximal tubule membranes followed by endocytosis and targeting of vitamin B12 to lysosomes. Polyclonal antibodies recognizing the approximately 460-kDa receptor inhibited the uptake. Immunohistochemistry of kidney and intestine showed colocalization of the IF-B12 receptor and megalin in both tissues. In conclusion, we have identified the epithelial IF-B12-binding receptor as a approximately 460-kDa RAP-binding protein facilitating endocytosis.     

A 127-kDa protein (UV-DDB) binds to the cytoplasmic domain of the Alzheimer's amyloid precursor protein

Alzheimer amyloid precursor protein (APP) is an integral membrane protein with a short cytoplasmic domain of 47 amino acids. It is hoped that identification of proteins that interact with the cytoplasmic domain will provide new insights into the physiological function of APP and, in turn, into the pathogenesis of Alzheimer's disease. To identify proteins that interact with the cytoplasmic domain of APP, we employed affinity chromatography using an immobilized synthetic peptide corresponding to residues 645-694 of APP695 and identified a protein of approximately 130 kDa in rat brain cytosol. Amino acid sequencing of the protein revealed the protein to be a rat homologue of monkey UV-DDB (UV-damaged DNA-binding protein, calculated molecular mass of 127 kDa). UV-DDB/p127 co-immunoprecipitated with APP using an anti-APP antibody from PC12 cell lysates. APP also co-immunoprecipitated with UV-DDB/p127 using an anti-UV-DDB/p127 antibody. These results indicate that UV-DDB/p127, which is present in the cytosolic fraction, forms a complex with APP through its cytoplasmic domain. In vitro binding experiments using a glutathione S-transferase-APP cytoplasmic domain fusion protein and several mutants indicated that the YENPTY motif within the APP cytoplasmic domain, which is important in the internalization of APP and amyloid beta protein secretion, may be involved in the interaction between UV-DDB/p127 and APP.     

Renal expression of transforming growth factor-beta inducible gene-h3 (beta ig-h3) in normal and diabetic rats

BACKGROUND: Transforming growth factor-beta (TGF-beta) has been implicated in the pathogenesis of a number of kidney diseases characterized by glomerulosclerosis and tubulointerstitial fibrosis. TGF-beta is secreted in a latent form requiring extracellular modification to become biologically active. TGF-beta inducible gene-h3 (beta ig-h3) is a recently identified TGF-beta-induced gene product. The present study sought to examine beta ig-h3 expression in normal and diabetic rats. METHODS: Beta ig-h3, TGF-beta1 and alpha1 (IV) collagen gene expression were assessed by Northern blot analysis and in situ hybridization in 20 Sprague Dawley rats, randomly assigned to receive streptozotocin (diabetic, N = 11) or citrate buffer alone (control, N = 9) and sacrificed eight months later. The effect of exogenous TGF-beta1 on beta ig-h3 expression was also assessed in cultured proximal tubular cells. RESULTS: In situ hybridization localized beta ig-h3 gene expression to the juxtaglomerular apparatus and the pars recta (S3 segment) of proximal tubules in both control and diabetic animals. Kidney TGF-beta 1, beta ig-h3 and alpha1 (IV) collagen mRNA from diabetic rats were increased two- to threefold compared with controls (P < 0.01). There was a significant correlation between TGF-beta1 and beta ig-h3 gene expression in kidneys from diabetic rats (r = 0.73, P = 0.01). In addition, beta ig-h3 mRNA increased in response to exogenous TGF-beta1 in a dose-dependent fashion in cultured proximal tubular cells. CONCLUSION: These findings support the hypothesis that biologically active TGF-beta plays a pathogenetic role in diabetic kidney disease and suggest that beta ig-h3 may be a useful index of TGF-beta1 bioactivity in the kidney.     

Characterization of a Goalpha mutant that binds xanthine nucleotides

Several GTP binding proteins, including EF-Tu, Ypt1, rab-5, and FtsY, and adenylosuccinate synthetase have been reported to bind xanthine nucleotides when the conserved aspartate residue in the NKXD motif was changed to asparagine. However, the corresponding single Goalpha mutant protein (D273N) did not bind either xanthine nucleotides or guanine nucleotides. Interestingly, the introduction of a second mutation to generate the Goalpha subunit D273N/Q205L switched nucleotide binding specificity to xanthine nucleotide. The double mutant protein GoalphaD273N/Q205L (GoalphaX) bound xanthine triphosphate, but not guanine triphosphate. Recombinant GoalphaX (GoalphaD273N/Q205L) formed heterotrimers with betagamma complexes only in the presence of xanthine diphosphate (XDP), and the binding to betagamma was inhibited by xanthine triphosphate (XTP). Furthermore, as a result of binding to XTP, the GoalphaX protein underwent a conformational change similar to that of the activated wild-type Goalpha. In transfected COS-7 cells, we demonstrate that the interaction between GoalphaX and betagamma occurred only when cell membranes were permeabilized to allow the uptake of xanthine diphosphate. This is the first example of a switch in nucleotide binding specificity from guanine to xanthine nucleotides in a heterotrimeric G protein alpha subunit.     

beta ig-h3: a transforming growth factor-beta-responsive gene encoding a secreted protein that inhibits cell attachment in vitro and suppresses the growth of CHO cells in nude mice

beta ig-h3 is a novel gene first discovered by differential screening of a cDNA library made from A549 human lung adenocarcinoma cells treated with transforming growth factor-beta 1 (TGF-beta 1). It encodes a 683-amino-acid protein containing a secretory signal sequence and four homologous internal domains. Here we show that treatment of several types of cells, including human melanoma cells, human mammary epithelial cells, human keratinocytes, and human fibroblasts, with TGF-beta resulted in a significant increase in beta ig-h3 RNA. A portion of the beta ig-h3 coding sequence was expressed in bacteria, and antisera against the bacterially produced protein was raised in rabbits. This antisera was used to demonstrate that several cell lines secreted a 68-kD beta IG-H3 protein after treatment with TGF-beta. Transfection of beta IG-H3 expression plasmids into Chinese hamster ovary (CHO) cells led to a marked decrease in the ability of these cells to form tumors in nude mice. The beta IG-H3 protein was purified from media conditioned by recombinant CHO cells, characterized by immunoblotting and protein sequencing and shown to function in an anti-adhesion assay in that it inhibited the attachment of A549, HeLa, and WI-38 cells to plastic in serum-free media. Sequencing of cDNA clones encoding murine beta ig-H3 indicated 90.6% conservation at the amino acid level between the murine and human proteins. Finally, the beta ig-h3 gene was localized to human chromosome 5q31, a region frequently deleted in preleukemic myelodysplasia and leukemia. The corresponding mouse beta ig-h3 gene was mapped to mouse chromosome 13 region B to C1, which confirms a region of conservation on human chromosome 5 and mouse chromosome 13. We suggest that this protein be named p68 beta ig-h3.     

Protein loop grafting to construct a variant of tissue-type plasminogen activator that binds platelet integrin alpha IIb beta 3

Protein-protein interactions can be guided by contacts between surface loops within proteins. We therefore investigated the hypothesis that novel protein-protein interactions could be created using a strategy of "loop grafting" in which the amino acid sequence of a biologically active, flexible loop on one protein is used to replace a surface loop present on an unrelated protein. To test this hypothesis we replaced a surface loop within an epidermal growth factor module with the complementarity-determining region of a monoclonal antibody. Specifically, the HCDR3 from Fab-9, an antibody selected to bind the beta 3-integrins with nanomolar affinity (Smith, J. W., Hu, D., Satterthwait, A., Pinz-Sweeney, S., and Barbas, C. F., III (1994) J. Biol. Chem. 269, 32788-32795), was grafted into the epidermal growth factor-like module of human tissue-type plasminogen activator (t-PA). The resulting variant of t-PA bound to the platelet integrin alpha IIb beta 3 with nanomolar affinity, retained full enzymatic activity, and was stimulated normally by the physiological co-factor fibrin. Binding of the novel variant of t-PA to integrin alpha IIb beta 3 was dependent on the presence of divalent cations and was inhibited by an RGD-containing peptide, demonstrating that, like the donor antibody, the novel t-PA binds specifically to the ligand-binding site of the integrin. These findings suggest that surface loops within protein modules can, at least in some cases, be interchangeable and that phage display can be combined with loop grafting to direct proteins, at high affinity, to selected targets. In principle, these targets could include not only other proteins but also peptides, nucleic acids, carbohydrates, lipids, or even uncharacterized markers of specific cell types, tissues, or viruses.     

Characterization and expression of a new class of zinc finger protein that binds to silencer region of ascorbate oxidase gene

A unique A/T-rich sequence (5'-AAAAAGTAAAAA-GTAAAAAAGTAAAAAG-3), referred to as the AGTA repeat, is found in the silencer region of the pumpkin ascorbate oxidase gene. A cDNA for protein (AOBP) that binds to the AGTA repeat was isolated from pumpkin by the southwestern method. The AOBP protein has a new class of zinc/DNA-binding domain named Dof/MOA domain that is highly conserved in many plant proteins and is significantly related to those of steroid hormone receptors and GATA1. Gel retardation analysis indicated that AOBP bound to the AGTA repeat through the Dof/MOA domain. Metal chelators, 1,10-phenanthroline and EDTA, specifically inhibited the DNA binding of AOBP, indicating that metal coordination plays an important role in DNA binding of AOBP. Thus, the Dof/MOA domain acts as a zinc/DNA-binding domain in AOBP. Gel retardation analysis with mutated oligonucleotides suggested that the Dof/MOA domain recognized the AGTA core sequence. AOBP mRNA was expressed in mature tissues of pumpkin, but was expressed only in small amounts or was not expressed in growing tissues. Furthermore, the expression was auxin-independent. The expression pattern of AOBP and that of ascorbate oxidase did not show a positive correlation.     

Gads is a novel SH2 and SH3 domain-containing adaptor protein that binds to tyrosine-phosphorylated Shc

Shc proteins are important substrates of receptor and cytoplasmic tyrosine kinases that couple activated receptors to downstream signaling enzymes. Phosphorylation of Shc tyrosine residues 239 and 317 leads to recruitment of the Grb2-Sos complex, thus linking Shc phosphorylation to Ras activation. We have used phosphorylated peptides corresponding to the regions spanning tyrosine 239/240 and 317 of Shc in an expression library screen to identify additional downstream targets of Shc. Here we report the identification of Gads, a novel adaptor protein most similar to Grb2 and Grap that contains amino and carboxy terminal SH3 domains flanking a central SH2 domain and a 120 amino acid unique region. Gads is most highly expressed in the thymus and spleen of adult animals and in human leukemic cell lines. The binding specificity of the Gads SH2 domain is similar to Grb2 and mediates the interaction of Gads with Shc, Bcr-Abl and c-kit. Gads does not interact with Sos, Cbl or Sam68, although the isolated carboxy terminal Gads SH3 domain is able to bind these molecules in vitro. Our results suggest that the unique structure of Gads regulates its interaction with downstream SH3 domain-binding proteins and that Gads may function to couple tyrosine-phosphorylated proteins such as Shc, Bcr-Abl and activated receptor tyrosine kinases to downstream effectors distinct from Sos and Ras.     

The Oms66 (p66) protein is a Borrelia burgdorferi porin

In this study we report the purification and characterization of a 66-kDa protein, designated Oms66, for outer membrane-spanning 66-kDa protein, that functions as a porin in the outer membrane (OM) of Borrelia burgdorferi. Oms66 was purified by fast-performance liquid chromatography and exhibited an average single-channel conductance of 9.62 +/- 0.37 nS in 1 M KCl, as evidenced by 581 individual insertional events in planar lipid bilayers. Electrophysiological characterization indicated that Oms66 was virtually nonselective between cations and anions and exhibited voltage-dependent closure with multiple substates. The amino acid sequence of tryptic peptides derived from purified Oms66 was identical to the deduced amino acid sequence of p66, a previously described surface-exposed protein of B. burgdorferi. Purified Oms66 was recognized by antiserum specific for p66 and serum from rabbits immune to challenge with virulent B. burgdorferi, indicating that p66 and Oms66 were identical proteins and that Oms66/p66 is an immunogenic protein in infected rabbits. In a methodology that reduces liposomal trapping and nonspecific interactions, native Oms66 was incorporated into liposomes, confirming that Oms66 is an outer membrane-spanning protein. Proteoliposomes containing Oms66 exhibited porin activity nearly identical to that of native, purified Oms66, indicating that reconstituted Oms66 retained native conformation. The use of proteoliposomes reconstituted with Oms66 and other Oms proteins provides an experimental system for determinating the relationship between conformation, protection, and biological function of these molecules.     

Isolation, characterization, and molecular cloning of a protein (Abp2) that binds to a Schizosaccharomyces pombe origin of replication (ars3002)

The autonomously replicating sequence (ARS) element ars3002 is associated with the most active replication origin within a cluster of three closely spaced origins on chromosome III of Schizosaccharomyces pombe. A 361-bp portion of ars3002 containing detectable ARS activity includes multiple near matches to the S. pombe ARS consensus sequence previously reported by Maundrell et al. (K. Maundrell, A. Hutchison, and S. Shall, EMBO J. 7:2203-2209, 1988). Using a gel shift assay with a multimer of an oligonucleotide containing three overlapping matches to the Maundrell ARS consensus sequence, we have detected several proteins in S. pombe crude extracts that bind to the oligonucleotide and ars3002. One of these proteins, ARS binding protein 1, was previously described (Abpl [Y. Murakami, J. A. Huberman, and J. Hurwitz, Proc. Natl. Acad. Sci. USA 93:502-507, 1996]). In this report the isolation, characterization, and cloning of a second binding activity, designated ARS binding protein 2 (Abp2), are described. Purified Abp2 has an apparent molecular mass of 75 kDa. Footprinting analyses revealed that it binds preferentially to overlapping near matches to the Maundrell ARS consensus sequence. The gene abp2 was isolated, sequenced, and overexpressed in Escherichia coli. The DNA binding activity of overexpressed Abp2 was similar to that of native Abp2. The deduced amino acid sequence contains a region similar to a proline-rich motif (GRP) present in several proteins that bind A+T-rich DNA sequences. Replacement of amino acids within this motif with alanine either abolished or markedly reduced the DNA binding activity of the mutated Abp2 protein, indicating that this motif is essential for the DNA binding activity of Abp2. Disruption of the abp2 gene showed that the gene is not essential for cell viability. However, at elevated temperatures the null mutant was less viable than the wild type and exhibited changes in nuclear morphology. The null mutant entered mitosis with delayed kinetics when DNA replication was blocked with hydroxyurea, and advancement through mitosis led to the loss of cell viability and aberrant formation of septa. The null mutant was also sensitive to UV radiation, suggesting that Abp2 may play a role in regulating the cell cycle response to stress signals.     

Suc1-associated neurotrophic factor target (SNT) protein is a major FGF-stimulated tyrosine phosphorylated 90-kDa protein which binds to the SH2 domain of GRB2

Low pH enhances tumor necrosis factor alpha (TNF)-induced cytolysis of cancer cells and TNF-membrane interactions that include binding, insertion, and ion-channel formation. We have also found that TNF increases Na+ influx in cells. Here, we examined the structural features of the TNF-membrane interaction pathway that lead to channel formation. Fluorometric studies link TNF's acid-enhanced membrane interactions to rapid but reversible acquisition of hydrophobic surface properties. Intramembranous photolabeling shows that (i) protonation of TNF promotes membrane insertion, (ii) the physical state of the target bilayer affects the kinetics and efficiency of TNF insertion, and (iii) binding and insertion of TNF are two distinct events. Acidification relaxes the trimeric structure of soluble TNF so that the cryptic carboxyl termini, centrally located at the base of the trimer cone, become susceptible to carboxypeptidase Y. After membrane insertion, TNF exhibits a trimeric configuration in which the carboxyl termini are no longer exposed; however, the proximal salt-bridged Lys-11 residues as well as regional surface amino acids (Glu-23, Arg-32, and Arg-44) are notably more accessible to proteases. The sequenced cleavage products bear the membrane-restricted photoreactive probe, proof that surface-cleaved TNF has an intramembranous disposition. In summary, the trimer's structural plasticity is a major determinant of its channel-forming ability. Channel formation occurs when cracked or partially splayed trimers bind and penetrate the bilayer. Reannealing leads to a slightly relaxed trimeric structure. The directionality of bilayer penetration conforms with x-ray data showing that receptor binding to the monomer interfaces of TNF poises the tip of the trimeric cone directly above the target cell membrane.     

Biochemical characterization of mapmodulin, a protein that binds microtubule-associated proteins

Mapmodulin is a 31-kDa protein that stimulates the microtubule- and dynein-dependent localization of Golgi complexes in semi-intact Chinese hamster ovary cells. We have shown previously that it binds the microtubule binding domains of the microtubule-associated proteins, MAP2, MAP4, and tau. We also showed that mapmodulin is identical to a protein named PHAPI (Vaesen, M., Barnikol-Watanabe, S. , G?tz, H., Awni, L.A., Cole, T., Zimmermann, B., Kratzin, H.D. and Hilschmann, N. (1994) Biol. Chem. Hoppe-Seyler 375, 113-126). We report here that mapmodulin is a phosphoprotein that is predominantly cytosolic but is also found peripherally associated with endoplasmic reticulum and Golgi membranes in mammalian cells. The protein occurs as a trimer in cytosol, and phosphorylation is required for its microtubule-associated protein-binding activity. Heat treatment of nonphosphorylated mapmodulin can render it competent for binding to microtubule-associated proteins, suggesting that phosphorylation induces a conformational change in mapmodulin. Finally, despite identity in polypeptide sequence with a protein reported to act as an inhibitor of protein phosphatase 2A, native mapmodulin was not able to inhibit protein phosphatase 2A in Chinese hamster ovary cell cytosol.     

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.     

Identification of a domain of Axin that binds to the serine/threonine protein phosphatase 2A and a self-binding domain

Axin is a negative regulator of embryonic axis formation in vertebrates, which acts through a Wnt signal transduction pathway involving the serine/threonine kinase GSK-3 and beta-catenin. Axin has been shown to have distinct binding sites for GSK-3 and beta-catenin and to promote the phosphorylation of beta-catenin and its consequent degradation. This provides an explanation for the ability of Axin to inhibit signaling through beta-catenin. In addition, a more N-terminal region of Axin binds to adenomatous polyposis coli (APC), a tumor suppressor protein that also regulates levels of beta-catenin. Here, we report the results of a yeast two-hybrid screen for proteins that interact with the C-terminal third of Axin, a region in which no binding sites for other proteins have previously been identified. We found that Axin can bind to the catalytic subunit of the serine/threonine protein phosphatase 2A through a domain between amino acids 632 and 836. This interaction was confirmed by in vitro binding studies as well as by co-immunoprecipitation of epitope-tagged proteins expressed in cultured cells. Our results suggest that protein phosphatase 2A might interact with the Axin.APC.GSK-3.beta-catenin complex, where it could modulate the effect of GSK-3 on beta-catenin or other proteins in the complex. We also identified a region of Axin that may allow it to form dimers or multimers. Through two-hybrid and co-immunoprecipitation studies, we demonstrated that the C-terminal 100 amino acids of Axin could bind to the same region as other Axin molecules.     

Mycobacterium leprae binds to a 25-kDa phosphorylated glycoprotein of human peripheral nerve

Mycobacterium leprae, the causative agent of leprosy, specifically invades and destroys the peripheral nerve, which results in the main clinical manifestation of the disease. Little is known about the bacteria-nerve protein interaction. We show in the present work that M leprae binds to a 25 kDa glycoprotein from human peripheral nerve. This protein is phosphorylatable and it binds to lectins which have alpha-mannose specificity. This M leprae-protein interaction could be of importance in the pathogenesis of leprosy.     

Characterization of a 34-kDa soybean binding protein for the syringolide elicitors

Syringolides are water-soluble, low-molecular-weight elicitors that trigger defense responses in soybean cultivars carrying the Rpg4 disease-resistance gene but not in rpg4 cultivars. 125I-syringolide 1 previously was shown to bind to a soluble protein(s) in extracts from soybean leaves. A 34-kDa protein that accounted for 125I-syringolide 1 binding activity was isolated with a syringolide affinity-gel column. Partial sequences of internal peptides of the 34-kDa protein were identical to P34, a previously described soybean seed allergen. In soybean seeds, P34 is processed from a 46-kDa precursor protein and was shown to have homology with thiol proteases. P34 is a moderately abundant protein in soybean seeds and cotyledons but its level in leaves is low. cDNAs encoding 46-, 34-, and 32-kDa forms of the soybean protein were cloned into the baculovirus vector, pVL1392, and expressed in insect cells. The resulting 32- and 34-kDa proteins, but not the 46-kDa protein, exhibited ligand-specific 125I-syringolide binding activity. These results suggest that P34 may be the receptor that mediates syringolide signaling.     

(-)-CGP 12177 causes cardiostimulation and binds to cardiac putative beta 4-adrenoceptors in both wild-type and beta 3-adrenoceptor knockout mice

Some blockers of beta1- and beta2-adrenoceptors cause cardiostimulant effects through an atypical beta-adrenoceptor (putative beta4-adrenoceptor) that resembles the beta3-adrenoceptor. It is likely but not proven that the putative beta4-adrenoceptor is genetically distinct from the beta3-adrenoceptor. We therefore investigated whether or not the cardiac atypical beta-adrenoceptor could mediate agonist effects in mice lacking a functional beta3-adrenoceptor gene (beta3 KO). (-)-CGP 12177, a beta1- and beta2-adrenoceptor blocker that causes agonist effects through both beta3-adrenoceptors and cardiac putative beta4-adrenoceptors, caused cardiostimulant effects that were not different in atria from wild-type (WT) mice and beta3 KO mice. The effects of (-)-CGP 12177 were resistant to blockade by (-)-propranolol (200 nM) but were blocked by (-)-bupranolol (1 microM) with an equilibrium dissociation constant of 15 nM in WT and 17 nM in beta3 KO. (-)-[3H]CGP 12177 labeled a similar density of the putative beta4-adrenoceptor in ventricular membranes from the hearts of both WT (Bmax = 52 fmol/mg protein) and beta3 KO (Bmax = 53 fmol/mg protein) mice. The affinity of (-)-[3H]CGP 12177 for the cardiac putative beta4-adrenoceptor was not different between WT (Kd = 46 nM) and beta3 KO (Kd= 40 nM). These results provide definitive evidence that the cardiac putative beta4-adrenoceptor is distinct from the beta3-adrenoceptor.     

The yeast telomere length regulator TEL2 encodes a protein that binds to telomeric DNA

TEL2 is required for telomere length regulation and viability in Saccharomyces cerevisiae. To investigate the mechanism by which Tel2p regulates telomere length, the majority (65%) of the TEL2 ORF was fused to the 3'-end of the gene for maltose binding protein, expressed in bacteria and the purified protein used in DNA binding studies. Rap1p, the major yeast telomere binding protein, recognizes a 13 bp duplex site 5'-GGTGTGTGGGTGT-3' in yeast telomeric DNA with high affinity. Gel shift experiments revealed that the MBP-Tel2p fusion binds the double-stranded yeast telomeric Rap1p site in a sequence-specific manner. Analysis of mutated sites showed that MBP-Tel2p could bind 5'-GTGTGTGG-3' within this 13 bp site. Methylation interference analysis revealed that Tel2p contacts the 5'-terminal guanine in the major groove. MBP-Tel2p did not bind duplex telomeric DNA repeats from vertebrates, Tetrahymena or Oxytricha. These results suggest that Tel2p is a DNA binding protein that recognizes yeast telomeric DNA.