Human DNA topoisomerase IIbeta binds and cleaves four-way junction DNA in vitro

We have used gel retardation analysis to show that human DNA topoisomerase IIbeta can bind a 40 bp linear duplex containing a single DNA topoisomerase IIbeta cleavage site. Furthermore, we demonstrate for the first time that human DNA topoisomerase IIbeta binds to four-way junction DNA. This supports previous suggestions that topoisomerase II may be targeted to supercoiled DNA through the recognition of DNA cruciforms, helix-helix crossovers and hairpins. DNA topoisomerase IIbeta had a 4-fold higher affinity for the four-way junction than for the linear duplex, as demonstrated by protein titration and competition analysis. Furthermore, the DNA topoisomerase IIbeta:four-way junction complex was significantly more salt stable than the complex with linear DNA. The four-way junction contained potential topoisomerase IIbeta cleavage sites straddling the points of strand exchange, and indeed, topoisomerase IIbeta was able to cleave three of these four predicted sites. This indicates that topoiso-merase IIbeta can bind to the centre of the junction. Topoisomerase II has to bind both the transported and the gated DNA helices prior to strand passage, and it is possible that both helices are provided by the four-way junction in this case. The stable complex of DNA topoisomerase IIbeta with four-way junction DNA may provide an ideal substrate for further studies into the mechanism of substrate recognition and binding by DNA topoisomerase II.     

Folding of the four-way RNA junction of the hairpin ribozyme

The hairpin ribozyme consists of two loop-carrying duplexes (called A and B) that are adjacent arms of a four-way junction in its natural context in the viral RNA. We have shown previously that the activity of the ribozyme is strongly influenced by the structure adopted by the junction. In this study, we have used fluorescence resonance energy transfer to analyze the conformation and folding of the isolated four-way junction. Like other four-way RNA junctions, in the absence of added metal ions this junction adopts a square configuration of coaxially stacked arms, based on A on D and B on C stacking. Upon addition of magnesium ions, the junction undergoes an ion-induced transition to an antiparallel conformation. The data are consistent with folding induced by the binding of a single ion, with an apparent association constant in the range of 2000 M-1. Other divalent metal ions (calcium or manganese) can also induce this change in structure; however, sodium ions are unable to substitute for these ions, and are slightly inhibitory with respect to the transition. The loop-free hairpin junction adopts the same stacking conformer as the full ribozyme, but forms a more symmetrical X-shaped structure. In addition, the apparent stoichiometry of structural ion binding is lower for the isolated junction, and the affinity is considerably lower.     

Structure of four-way DNA junctions containing a nick in one strand

We have investigated the structure of the four-way helical DNA junction containing a single covalent discontinuity (nick) in one strand. These could result from either unitary strand exchange processes, or the action of nucleases upon a complete junction. We have employed gel electrophoresis methods to study the global configuration of arms in these junctions. We find that the junction carrying a nick in one strand undergoes a folding process in the presence of magnesium ion concentrations greater than 200 microM. Comparison of the electrophoretic mobilities of the six possible derivative junctions with two long and two shortened arms suggests that the folding occurs by coaxial stacking of pairs of helical arms, which is supported by the suppression of reactivity to osmium tetroxide of thymine bases at the centre of the junction. However, unlike the complete junction (i.e. the junction without nicked strands), the two stacked pairs of helices lie at a mutual angle of approximately 90 degrees. The folding process generates two kinds of strands; two continuous strands and two exchanging strands. Two isomers of the right-angled stacked structure are possible, depending on the selection of stacking partners; it appears that the critical factor determining the relative stabilities of these isomers is the location of the nick. Thus the nicked junctions fold into the isomer that locates the nick on the exchanging strand. However, if the nick is not located at the point of strand exchange, the junction reverts to the stacked X-structure of the complete junction, even if the nick is moved by a single base-pair. These results suggest that the exchanging strands may be significantly strained in the structure of the complete four-way junction, such that an interruption to the continuity at this position allows the two stacked helices to disengage, and rotate to an angle where the overall electrostatic repulsion may be lower.     

Interaction of RecBCD enzyme with DNA at double-strand breaks produced in UV-irradiated Escherichia coli: requirement for DNA end processing

The RecBCD enzyme has a powerful duplex DNA exonuclease activity in vivo. We found that this activity decreased strongly when cells were irradiated with UV light (135 J/m2). The activity decrease was seen by an increase in survival of phage T4 2(-) of about 200-fold (phage T4 2(-) has defective duplex DNA end-protecting gene 2 protein). The activity decrease depended on excision repair proficiency of the cells and a postirradiation incubation. During this time, chromosome fragmentation occurred as demonstrated by pulsed-field gel electrophoresis. In accord with previous observations, it was concluded that the RecBCD enzyme is silenced during interaction with duplex DNA fragments containing Chi nucleotide sequences. The silencing was suppressed by induction or permanent derepression of the SOS system or by the overproduction of single-strand DNA binding protein (from a plasmid with ssb+) which is known to inhibit degradation of chromosomal DNA by cellular DNases. Further, mutations in xonA, recJ, and sbcCD, particularly in the recJ sbcCD and xonA recJ sbcCD combinations, impeded RecBCD silencing. The findings suggest that the DNA fragments had single-stranded tails of a length which prevents loading of RecBCD. It is concluded that in wild-type cells the tails are effectively removed by single-strand-specific DNases including exonuclease I, RecJ DNase, and SbcCD DNase. By this, tailed DNA ends are processed to entry sites for RecBCD. It is proposed that end blunting functions to direct DNA ends into the RecABCD pathway. This pathway specifically activates Chi-containing regions for recombination and recombinational repair.     

Interaction of non-histone chromosomal proteins HMG1 and HMG2 with DNA

Interaction between non-histone protein HMG1 or HMG2 and DNA has been studied by using thermal denaturation and circular dichroism (CD) spectroscopy. We have made the following observations. 1. The binding of each of these two proteins to DNA stabilizes the latter, as shown by an increase in melting temperature of 20 degrees C (from 45 degrees C to about 65 degrees C). 2. There are 6.0 amino acids/nucleotide in HMG1-bound DNA and 5.0 in HMGI-bound DNA which suggests that each HMB1 moleculae would cover about 20 base pairs of DNA and each HMG2 molecule would cover about 25 base pairs. 3. The alpha-helical content of these two non-histone proteins in the complexes, estimated from the CD value at 220 nm, is about one third to one half that of total proteins in calf thymus chromatin. 4. DNA conformation is distorted only slightly by the binding of protein HMG1 or HMG2. 5. Neither the melting nor the CD properties of HMG1-DNA or HMG2-DNA complexes differ substantially whether they are prepared by NaCl-gradient dialysis in urea or by direct mixing of protein and DNA at 0.15 M NaCl, followed by dialysis against the same buffer i.e. 0.25 mM EDTA (pH 8.0).     

Interaction of Complex of Europium and Hbbimp with DNA

TheartificialnucleasesforcleavingDNAhavebecomemoreimportant.Theenzymesystemmimicing theenzymaticsiteisthedicopperenzymehemocyanin thathasattractedmoreinterest[1～5].Somestudiesre portedthatmanynaturalenzymeswiththegoodactivi tiesalwayscontaintwoorthreeint…     

Interaction of histone H1 with cis-platinum modified DNA

Cis-diamminedichloroplatinum(II) (cis-DDP) is known as an effective anticancer drug. Its therapeutic effect is supposed to be a consequence of the covalent binding to DNA. A number of cellular proteins were found to bind selectively to DNA modified by cis-DDP (but not by its isomer trans-DDP). Here we present our observations on interaction of the linker histone H1 with cis- and trans-DDP modified DNA fragments. The results afford new experimental information about the preferential binding of histone H1 to cis-DDP-distorted DNAs versus trans-DDP modified ones.     

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.     

Interaction of divalent cadmium ions with nucleotides and native DNA

In normal embryos, mRNA encoding platelet-derived growth factor A (PDGF A) and the platelet-derived growth factor receptor alpha (PDGFR alpha) are found within and adjacent to the site of vertebral development, the sclerotome. These patterns of expression are consistent with PDGF action on the developing sclerotome and dermis. Homozygous Patch (Ph) mutant mouse embryos lack the receptor gene (Pdgfra) due to an extensive deletion at that locus. Consistent with the spatial pattern of Pdgfra expression, striking deformities are found in the spine and ribcage of Ph/Ph embryos. In particular, we show that late-gestation Ph/Ph embryos have occult spina bifida involving the entire spinal column. We have analyzed the progression of the axial defects in homozygous Patch embryos in detail. By late gestation it appears that the components of the vertebrae are present, yet the neural arches of the spine are misshapen. We propose that PDGF A is required for proper positioning of the neural arch condensation at all axial levels. Furthermore, since the neural tube appears to close normally, we suggest that spina bifida in the Ph homozygote is caused primarily by a somitic mesoderm abnormality rather than a neural tube defect.     

Mechanism of action of acetyl kidamycin. I. Interaction with DNA

During the period from November 1972 to February 1975, 39 patients received second renal grafts in our institution. The clinical course of the patients was analyzed and compared with 121 patients who received only one graft during the same period. The graft survival either from living related or cadaveric sources was inferior in the second graft group. However, mortality was not increased by re-transplantation. Major differences were noted in the occurrence of hyperacute or accelerated type rejections. There was a high incidence of this type of rejection in the second graft group, especially in the simultaneous retransplant group.     

Novel DNA binding motifs in the DNA repair enzyme endonuclease III crystal structure

The 1.85 A crystal structure of endonuclease III, combined with mutational analysis, suggests the structural basis for the DNA binding and catalytic activity of the enzyme. Helix-hairpin-helix (HhH) and [4Fe-4S] cluster loop (FCL) motifs, which we have named for their secondary structure, bracket the cleft separating the two alpha-helical domains of the enzyme. These two novel DNA binding motifs and the solvent-filled pocket in the cleft between them all lie within a positively charged and sequence-conserved surface region. Lys120 and Asp138, both shown by mutagenesis to be catalytically important, lie at the mouth of this pocket, suggesting that this pocket is part of the active site. The positions of the HhH motif and protruding FCL motif, which contains the DNA binding residue Lys191, can accommodate B-form DNA, with a flipped-out base bound within the active site pocket. The identification of HhH and FCL sequence patterns in other DNA binding proteins suggests that these motifs may be a recurrent structural theme for DNA binding proteins.     

Interaction of human SRY protein with DNA: a molecular dynamics study

Molecular dynamics simulations have been conducted to study the interaction of human sex-determining region Y (hSRY) protein with DNA. For this purpose, simulations of the hSRY high mobility group (HMG) domain (hSRY-HMG) with and without its DNA target site, a DNA octamer, and the DNA octamer alone have been carried out, employing the NMR solution structure of hSRY-HMG-DNA complex as a starting model. Analyses of the simulation results demonstrated that the interaction between hSRY and DNA was hydrophobic, just a few hydrogen bonds and only one water molecule as hydrogen-bonding bridge were observed at the protein-DNA interface. These two hydrophobic cores in the hSRY-HMG domain were the physical basis of hSRY-HMG-DNA specific interaction. They not only maintained the stability of the complex, but also primarily caused the DNA deformation. The salt bridges formed between the positive-charged residues of hSRY and phosphate groups of DNA made the phosphate electroneutral, which was advantageous for the deformation of DNA and the formation of a stable complex. We predicted the structure of hSRY-HMG domain in the free state and found that both hSRY and DNA changed their conformations to achieve greater complementarity of geometries and properties during the binding process; that is, the protein increased the angle between its long and short arms to accommodate the DNA, and the DNA became bent severely to adapt to the protein, although the conformational change of DNA was more severe than that of the hSRY-HMG domain. The sequence specificity and the role of residue Met9 are also discussed.     

Interaction of Escherichia coli DNA polymerase I (Klenow fragment) with primer-templates containing N-acetyl-2-aminofluorene or N-2-aminofluorene adducts in the active site

DNA adducts formed by aromatic amines such as N-acetyl-2-aminofluorene (AAF) and N-2-aminofluorene (AF) are known to cause mutations by interfering with the process of DNA replication. To understand this phenomenon better, a gel retardation assay was used to measure the equilibrium dissociation constants for the binding of an exonuclease-deficient Escherichia coli DNA polymerase I (Klenow fragment) to DNA primer-templates modified with an AAF or AF adduct. The results indicate that the nature of the adduct as well as the presence and nature of an added dNTP have a significant influence on the strength of the binding of the polymerase to the DNA. More specifically, it was found that the binding is 5-10-fold stronger when an AAF adduct, but not an AF adduct, is positioned in the enzyme active site. In addition, the polymerase was found to bind the unmodified primer-template less strongly in the presence of a noncomplementary dNTP than in the presence of the correct nucleotide. The same trend holds true for the primer-template having an AF adduct, although the magnitude of this difference was lower. In the case of the AAF adduct, the interaction of the polymerase with the primer-template was stronger and almost independent of the nucleotide present.     

Introduction of DNA into rat liver with a hand-held gene gun: distribution of the expressed enzyme, [32P]DNA, and Ca2+ flux

DNA-coated Au particles were accelerated by pressurized He gas to supersonic velocities for introduction of a gene into cells. Experimental and theoretical analyses both revealed a heterogeneous distribution of the particles per shot (1 mg Au = 2.4 x 10(7) particles with 2 microg [32P] DNA = 2.5 x 10(11) moles). For introduction of genes into the liver of living rats, the best results were obtained with a newly developed hand-held gene delivery system. The beta-galactosidase gene introduced into rat liver with Au particles by He at 250 psi was expressed (1.2 microunits/microg protein) in a limited area of the liver surface (8 x 8 mm, depth 0.5 mm). When the same gene gun was used on a monolayer of cultured COS7 cells (about 5 microm thick), cells were lost in the central area of heavy bombardment. Cell death caused by influx of Ca2+ was prevented by the use of the cytosol-type culture medium.     

Interaction of ethidium bromide with DNA: effect of LiCl and ethylene glycol

The interaction of the intercalating dye ethidium bromide with several native and synthetic polydeoxyribonucleic acids has been studied by means of circular dichroic spectra. The CD of DNA-ethidium bromide complexes in the 290-360 nm region is characterized, especially at high salt and at high ethylene glycol content, by positive and negative bands near 308 nm and 295 nm, respectively. These dye associated CD bands are unaffected by the addition of LiCl or ethylene glycol, suggesting that the relative conformation of dye and neighboring base pairs does not change when the conformation of the rest of the DNA changes.