Homogenization modeling for the mechanics of perfused myocardium

Altered coronary perfusion can change the apparent diastolic stiffness of ventricular myocardium--the 'garden hose' effect. Our recent findings showed that myocardial strains are reduced during ventricular filling, primarily along the directions transverse to the coronary microvessels. In this article, we review hypotheses and theoretical models regarding the role that regional wall stress plays in the mechanical interaction between myocardium and coronary circulation. Various mechanisms have been used to explain the effects of the tissue stress on coronary flow, as well as the effect of coronary dynamics on myocardial mechanics. Many models of coronary pressure-flow relations using lumped parameter circuit analogs. Poroelasticity and swelling theories have been used to model the mechanics of perfused muscle. Here, we describe a new mathematical model of the mechanics of perfused myocardium derived using homogenization theory. In this model, perfused myocardium is treated as a nonlinear anisotropic elastic solid embedded with cylindrical vessels of known distensibility. The solid compartment is incompressible but the vascular compartment may change volume according to a simple relation between vessel diameter and perfusion pressure. The work done by the perfusion pressure in changing vascular volume contributes to the macroscopic strain energy and hence affects the stress and stiffness of the composite. Conversely, the stress in the tissue affects microvessel diameter and volume, since tractions transverse to the vessel axis oppose the internal blood pressure. Finite element simulations of passive filling show good agreement of model with experimental results.     

Molecular dynamics simulation of a 13-mer duplex DNA: a PvuII substrate

Parallel version of AMBER 4.1 was ported and optimised on the Indian parallel supercomputer PARAM OpenFrame built around Sun Ultra Sparc processors. This version of AMBER program was then used to carry out molecular dynamics (MD) simulations on 5'-TGACCAGCTGGTC-3', a substrate for PvuII enzyme. MD simulations in water are carried out under following conditions: (i) unconstrained at 300 K (230 ps); (ii) unconstrained at 283 K (500 ps); (iii) Watson-Crick basepair constrained at 283 K (1 ns); and (iv) Watson-Crick basepair constrained with ions at 283 K (1.2 ns). In all these simulation studies, the molecule was observed to be bending and maximum distortions in the double helix around was seen around the G7:C7' basepair, which is the phosphodiester bond that is cleaved by PvuII. Analysis of MD simulation with ions carried out for 1.2 ns also pointed out that the conformation of double helix alternates between a conformation close to B-form and close to A-form. It is argued that a bent non-standard conformation is recognised by the PvuII enzyme. The maximum bend occurs at the G7:C7' region, weakening the phosphodiester bond and allows His48 to get placed in such a fashion to permit the scission through a general base mechanism. The bending and distortion observed is a property of the sequence which acts as a substrate for PvuII enzyme. This is confirmed by carrying out MD studies on the Dickerson's sequence d(CGCGAATTCGCG)2 as a reference molecule, which practically does not bend or get deformed.     

Molecular modeling of N-isopropyl lisergamides analogous to LSD using molecular mechanics and quantum mechanical calculations

A male white patient 58 years-old was submitted to colonoscopy for follow-up of surgical resection of an advanced colorectal carcinoma 33 months ago. Small polyps were observed in the colons and histopathological examination proved to be tubular adenomas with moderate dysplasia. At the hepatic flexure of the transverse colon a large flat-elevated laterally spreading tumor measuring 2.5 cm in diameter was observed. After spraying of methilene-blue 0.1% the margins of the lesion were demarcated and following saline injection under the lesion it was completely resected in one single procedure. Histologically, the lesion was diagnosed as intramucosal adenocarcinoma.     

Molecular dynamics investigations of DNA triple helical models: unique features of the Watson-Crick duplex

We have built computer models of triple helical structures with a third poly(dT) strand Hoogsteen base paired to the major groove of a poly(dA).poly(dT) Watson-Crick (WC) base-paired duplex in the canonical A-DNA as well as B-DNA. For the A-DNA form, the sugar-phosphate backbone of the third strand intertwines and clashes with the poly(dA) strand requiring a radical alteration of the duplex to access the hydrogen bonding sites in the major groove. In contrast, when the duplex was in the canonical B-DNA form, the third strand was readily accommodated in the major groove without perturbing the duplex. The triple helical model, with the duplex in the B-DNA form, was equilibrated for 400ps using molecular dynamics simulations including water molecules and counter-ions. During the entire simulations, the deoxyriboses of the adenine strand oscillate between the S-type and E-type conformations. However, 30% of the sugars of the thymine strands-II & III switch to the N-type conformation early in the simulations but return to the S-type conformation after 200ps. In the equilibrium structure, the WC duplex portion of the triplex is unique and its geometry differs from both the A- or B-DNA. the deoxyriboses of the three strands predominantly exhibit S-type conformation. Besides the sugar pucker, the major groove width and the base-tilt are analogous to B-DNA, while the X-displacement and helical twist resemble A-DNA, giving a unique structure to the triplex and the Watson & Crick and Hoogsteen duplexes.     

Molecular mechanics of calcium-myristoyl switches

Many eukaryotic cellular and viral proteins have a covalently attached myristoyl group at the amino terminus. One such protein is recoverin, a calcium sensor in retinal rod cells, which controls the lifetime of photoexcited rhodopsin by inhibiting rhodopsin kinase. Recoverin has a relative molecular mass of 23,000 (M[r] 23K), and contains an amino-terminal myristoyl group (or related acyl group) and four EF hands. The binding of two Ca2+ ions to recoverin leads to its translocation from the cytosol to the disc membrane. In the Ca2+-free state, the myristoyl group is sequestered in a deep hydrophobic box, where it is clamped by multiple residues contributed by three of the EF hands. We have used nuclear magnetic resonance to show that Ca2+ induces the unclamping and extrusion of the myristoyl group, enabling it to interact with a lipid bilayer membrane. The transition is also accompanied by a 45-degree rotation of the amino-terminal domain relative to the carboxy-terminal domain, and many hydrophobic residues are exposed. The conservation of the myristoyl binding site and two swivels in recoverin homologues from yeast to humans indicates that calcium-myristoyl switches are ancient devices for controlling calcium-sensitive processes.     

Molecular mechanics of nucleic acid sequence amplification

Protocols for in vitro amplification of nucleic acids are proliferating and there are now several methods that will contribute both to genetic research and to the diagnosis of a wide range of diseases. Here, I present the working principles of some of these molecular machines for amplifying DNA or RNA and discuss the lines along which new methods of amplifying nucleic acids may be developed.     

Predicting sequence-dependent melting stability of short duplex DNA oligomers

Many important applications of DNA sequence-dependent hybridization reactions have recently emerged. This has sparked a renewed interest in analytical calculations of sequence-dependent melting stability of duplex DNA. In particular, for many applications it is often desirable to accurately predict the transition temperature, or tm of short duplex DNA oligomers (approximately 20 base pairs or less) from their sequence and concentration. The thermodynamic analytical method underlying these predictive calculations is based on the nearest-neighbor model. At least 11 sets of nearest-neighbor sequence-dependent thermodynamic parameters for DNA have been published. These sets are compared. Use of the nearest-neighbor sets in predicting tm from the DNA sequence is demonstrated, and the ability of the nearest-neighbor parameters to provide accurate predictions of experimental tm's of short duplex DNA oligomers is assessed.     

Probabilistic modeling of shear-induced formation and breakage of doublets cross-linked by receptor-ligand bonds

A model was constructed to describe previously published experiments of shear-induced formation and breakage of doublets of red cells and of latexes cross-linked by receptor-ligand bonds (. Biophys. J. 65:1318-1334; Tees and Goldsmith. 1996. Biophys. J. 71:1102-1114;. Biophys. J. 71:1115-1122). The model, based on McQuarrie's master equations (1963. J. Phys. Chem. 38:433-436), provides unifying treatments for three distinctive time periods in the experiments of particles in a Couette flow in which a doublet undergoes 1) formation upon two-body collision between singlets; 2) evolution of bonds at low shear rate; and 3) break-up at high shear rate. Neglecting the applied force at low shear rate, the probability of forming a doublet per collision as well as the evolution of probability distribution of bonds in a preformed doublet were solved analytically and found to be in quite good agreement with measurements. At high shear rate with significant force acting to accelerate bond dissociation, the predictions for break-up of doublets were obtained numerically and compared well with data in both individual and population studies. These comparisons enabled bond kinetic parameters for three types of particles cross-linked by two receptor-ligand systems to be calculated, which agreed well with those computed from Monte Carlo simulations. This work can be extended to analyze kinetics of receptor-ligand binding in cell aggregates, such as those of neutrophils and platelets in the circulation.     

Triplex-directed self-assembly of an artificial sliding clamp on duplex DNA

Little is known about extrinsic-intrinsic reflexes, especially the prototype combinative extensor hallucis response, which become apparent if proprioceptive and exteroceptive afferents of the concerning muscles are stimulated simultaneously as well as successively. With reference to this phenomenon, data from 604 patients were evaluated under neurological aspects. With the exception of the combinative reflex of the peroneal muscles, the occurrence of other combinative reflexes (of tibial posterior, anterior and extensor hallucis muscles) was of clinical relevance. All these characteristics, in the same way as Tramer's reflex and unilateral tibialis posterior reflex, correlated very well statistically with typical symptoms of an upper motor neurone syndrome. In this context the extensor hallucis combinative response is the most important one. This particular sign occurred in a systematically examined population of patients twice as often as Babinski's sign and was the single reflex anomaly in 7 per cent of 200 systematically examined cases. A double-sided manifestation, which could be seen exclusively as physiological, appeared in less than 2 per cent of 604 cases. In respect of the occurrence of combinative responses, patients belonging to different diagnostic groups, infants as well as adults, did not have statistically the same basic probability with regard to the examined neurological signs. Hence, an examination of healthy persons would not yield essential evidence. In our opinion such combinative reflexes and the other symptoms mentioned may be useful in detecting latent upper motor neuron lesion or may be helpful in doubtful cases. Whether or not the phenomenon of a combinative reflex really represents part of the latent pathognomonic flexor withdrawal reflex, cannot be decided with our clinical methods.     

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.     

Molecular modeling of the conformational complexity of (+)-anti-B[a]PDE-adducted DNA using simulated annealing

Benzo[a]pyrene (B[a]P), a potent mutagen/carcinogen, reacts with DNA following metabolism to its corresponding (+)-anti-7,8-diol-9,10-epoxide [(+)-anti-B[a]PDE], giving a major adduct (+)-trans-anti-B[a]P-N2-dG. Evidence suggests that this adduct is responsible for most of the different kinds of mutations (e.g. G-->T, G-->A, etc.) induced by (+)-anti-B[a]PDE, raising the question of how can a single adduct cause many different kinds of mutations? One hypothesis is that different mutations are induced depending upon the conformation of this adduct when bypassed during DNA replication. If true, then it becomes imperative to explore different reasonable conformations for this adduct. Herein a simulated annealing protocol is employed to study the conformation of (+)-trans-anti-B[a]P-N2-dG with the B[a]P moiety in the minor groove and pointing toward the base on its 5'-side in a 5'-CGC-3' sequence context in duplex DNA. This conformation and sequence were chosen because there is a structure derived from NMR constraints for comparison. A four step procedure is followed: the adduct is docked in canonical B-DNA, after which the structure is subjected to an initial conjugate gradient minimization, followed by simulated annealing and a final conjugate gradient minimization. The quality and final energy of structures is assessed as a function of changes in six parameters, including the length of the DNA helix, the initial annealing temperature (T0), the annealing time (t), the molecular dynamics time step (tau) and two other parameters. While there is no single set of optimum parameters, reasonable low energy structures were obtained using the values t approximately 40 ps (or longer), T0 approximately 750 K and tau approximately 1.0 fs with a helix length of 7 bp. The structures that emerge all retain the basic features of the input structure, being B-DNA-like with the B[a]P moiety in the minor groove pointing toward the base on the 5'-side. However, within this broad category there are at least six subclasses of structures, of which four have lowest energy members that differ by < approximately 5 kcal/mol. The fact that a variety of distinct but related structures emerge from a single starting structure as this parameter set is varied suggests that the use of a large but manageable number of simulated annealing runs should be considered in the search for a cohort of related structures. This is especially important given that this breadth of potentially relevant structures of approximately the same energy may indeed be relevant to the hypothesis that different mutations arise from a single adduct in different conformations.     

Induced-fit association between DNA and esperamicin. Importance of structural flexibility in host DNA duplex

In this study, a series of synthetic oligonucleotide duplexes are tested as a substrate for esperamicin. The duplexes contain a typical binding sequence of esperamicin, 5'-GGA/TCC, but have different flexibilities in helix structure from each other. When cleavage activities of these oligonucleotides by esperamicin were estimated by using DNA sequencing method, a substantial increase of the cleavage at 3'-NAGG was observed with increasing the helix flexibility. This observation indicates that structural flexibility of host DNA duplex is important in an induced-fit association between esperamicin and DNA.     

Isolation of circular viral and complementary strand DNA from bacteriophage f1 duplex replicative-form DNA

A general method has been developed for the large scale isolation of intact, circular, single-stranded DNA molecules of each strand from supercoiled duplex DNA. The method involves the conversion of the supercoiled duplex DNA to singly nicked, relaxed duplex DNA; denaturation of the duplex DNA; separation of circular DNA molecules from linear DNA molecules; and separation of circular plus and minus strands. All separations involve zone sedimentation. No isopycnic gradient centrifugation is required. The last step in the purification, the separation of plus and minus strands, can be easily adapted for small scale analytical measurements of the amounts of plus and minus strand DNA.     

Search for DNA repair inhibitors: selective binding of nucleic bases-acridine conjugates to a DNA duplex containing an abasic site

The abasic site is one of the most frequent DNA lesions generated by spontaneous or enzymatic cleavage of the N-glycosidic bond. The abasic site is also an intermediate in the nucleotide and base excision DNA repair. We examined molecules which recognize and cleave DNA at the abasic site with high efficiency. These molecules incorporate in their structure a nucleic base for abasic site recognition, an intercalator for DNA binding, and a polyamino linker for ionic interaction and DNA cleavage. Such compounds, by interfering with abasic sites in DNA, are also inhibitors of DNA repair. In order to better understand the parameters of the interaction, we carried out a UV thermal denaturation study of synthetic oligonucleotides containing the lesion both in the absence and in the presence of the drugs. A similar study was also carried out using the corresponding nonmodified oligonucleotide. The results indicate selective binding of the base-chain-intercalator conjugates to the abasic site containing oligonucleotides.     

Bombyx mori nucleopolyhedrovirus encodes a DNA-binding protein capable of destabilizing duplex DNA

A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3'-->5' exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication.     

Molecular biological characterization of adenovirus DNA

The agarose gel electrophoresis of DNA, the ethidium bromide fluorescence detection of DNA fragments and restriction endonucleases were discovered at the end of the '60s. The methodological progress enabled institutions equipped with less sophisticated technology to achieve also unique experimental and scientific results in the field of viral DNA research. The team working on virus DNA within the adenovirus research group has constructed several new restriction endonuclease maps of the genomes of human and animal adenoviruses; contributed to the methodology of the determination of specific endonuclease sites, and genome polarity; discovered new restriction endonucleases, adenovirus subtypes, new empty capsid, and genome subpopulations; participated in cooperations leading to novel, although hypothetical approaches in AIDS therapy, taxonomic definition of viruses, and evolutionary origins of adenovirus replication and encapsidation strategy.     

Molecular modeling of the enantioselectivity in lipase-catalyzed transesterification reactions

Two strategies based on the use of subsets for calculating the enantioselectivity in lipase-catalyzed transesterifications using the CHARMM force field were investigated. Molecular dynamics was used in our search for low energy conformations. Molecular mechanics was used for refining these low energy conformations. A tetrahedral intermediate with a rigid central part was used for mimicking the transition state. The energy differences between the transition states of the diastereomeric enzyme-substrate complexes were calculated. The way of defining the subsets was based on two fundamentally different strategies. The first strategy used predefined parts of the enzyme and the substrate as subsets. The second approach formed energy-based subsets, varying in size with the substrates studied. The selection of residues to be included in these energy-based subsets was based on the energy of the interaction between the specific residue or water molecule and the transition state. The reaction studied was the kinetic resolution of secondary alcohols in transesterifications using the Candida antarctica lipase B as chiral biocatalyst. The secondary alcohols used in the study were 2-butanol, 3-methyl-2-butanol, and 3,3-dimethyl-2-butanol.