RNA synthesis in spermatocytes and spermatids and preservation of meiotic RNA during spermiogenesis in the mouse

The rate of RNA synthesis at different stages of spermatogenesis in the mouse, and the preservation of RNA from the diploid to the haploid phase of spermatogenesis were studied in homogeneous germ cell fractions separated by velocity sedimentation at unit gravity. The uridine pool expansion method was used for determining the rate of RNA synthesis: seminiferous tubules were labelled in culture with increasing concentrations of [3H]-uridine and the incorporated radioactivity was estimated in cell fractions separated by velocity sedimentation. The results indicate that before nuclear elongation, round spermatids (steps 1 to 8 of spermiogenesis) synthesize RNA at the same rate per DNA content as middle-late pachytene spermatocytes. The preservation of RNA molecules synthesized in meiosis was investigated by labelling pachytene spermatocytes with T3H]uridine in vivo and collecting samples of germ cells at definite stages of spermatogenesis at various time intervals thereafter. The results show that a considerable proportion the RNA synthesized during the pachytene stage is preserved through spermatid development until late spermiogenesis.     

Kinetics of erythroid cell precursors in the newborn rat

The nuclear organization of a particular step of cricket late spermiogenesis was examined by an electron microscope study of spermatids dispersed by air-liquid surface tension. Cell spreading techniques facilitate a display of condensing spermatid nuclei sufficient to allow interpretation of chromatin packaging processes. Results indicate that nuclei of late developing cricket spermatids are integrated by multiple packaging units as the result of an orderly aggregation of individual chromatin fibers. Each packaging unit consists of a thick fasicle, formed by the alignment of smooth chromatin fibers, which frays out into tassels of looped fibers.     

Selective deuteration of RNA for NMR signal assignment

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.     

Ultrastructural study on cytotoxic effects of cyclosporine A in spermiogenesis in rats

Cyclosporine A (CsA) is known to have testicular toxicity, leading to male infertility. The occurrence of numerous anomalous spermatids and residual bodies in the epididymal ducts of rats treated with CsA was observed in our previous studies. To examine the fine structural changes of impaired spermiogenesis induced by CsA, rats were treated s.c. with 40 mg/kg/day CsA for 2 weeks. Desquamation of round spermatids still surrounded by a slender Sertoli cell cytoplasm was occasionally observed. A prominent change in the seminiferous tubules was an occurrence of numerous residual bodies containing one or more flagella. They were not phagocytosed by the Sertoli cell, and accumulated in the epididymal ducts. Cellular components in the epididymal lumen included degenerating round spermatids and abnormal spermatozoa and residual bodies. Although separation of the head from the tail of the spermatozoa was rarely seen, various kinds of abnormalities of flagella were frequently encountered; compact aggregation of numerous flagella in a single spermatozoon or residual body, disarrangement of mitochondrial or fibrous sheath with outer dense fibers, and fusion of flagella with a single intervening mitochondrial layer. These findings indicate that CsA gives rise to toxic effects on the spermiogenesis by impairing directly the spermiogenic cell development and by impeding Sertoli cell function including a reduction of its phagocytic activity.     

Immunohistochemical localization of a water channel, aquaporin 7 (AQP7), in the rat testis

Cell volume reduction is one of the most distinct morphological changes during spermiogenesis and may be largely attributable to water efflux from the cell. A strong candidate for a water efflux route, aquaporin 7 (AQP7), which is a water channel, was studied immunohistochemically in the rat testis. Immunoreactivity was restricted within the elongated spermatids, testicular spermatozoa, and residual bodies remaining in the seminiferous epithelium. Weak but distinct immunoreactivity was first observed in the cytoplasmic mass of the spermatid at step 8 of spermiogenesis. The Golgi-like apparatus became steadily immunoreactive at step 10. The plasma membrane covering the cytoplasmic mass showed strong immunoreactivity after step 16. At this step, the middle piece of the tail also showed immunoreactivity at the portion protruding into the lumen. The whole head and distal tail, where the elongated spermatid had only a limited amount of cytoplasm, showed no immunoreactivity throughout spermiogenesis. After spermiation, the immunoreactivity of AQP7 remained at the middle piece and in the cytoplasmic droplet in the testicular spermatozoon. The present observations suggest that AQP7 contributes to the volume reduction of spermatids, since this water channel protein is localized on the plasma membrane covering the condensing cytoplasmic mass of the elongated spermatid, and since the seminiferous tubule fluid is hypertonic.     

Electrosynthesized non-conducting polymers as permselective membranes in amperometric enzyme electrodes: a glucose biosensor based on a co-crosslinked glucose oxidase/overoxidized polypyrrole bilayer

The sperm plasma membrane is segregated into functionally, biochemically, and structurally distinct domains yet the protein sorting pathways and assembly mechanisms that assemble these domains during spermiogenesis are incompletely understood. We previously characterized two structurally related size-variant, integral membrane proteins of 52 kDa (PM52) and 35 kDa localized to the periacrosomal plasma membrane of guinea pig cauda epididymal spermatozoa (Westbrook-Case et al., 1994). In this study we used light and electron microscopic immunocytochemistry to define the expression pattern and sorting pathway that establishes the domain-specific distribution of PM52 during spermiogenesis. The PM52 is first expressed in acrosome-phase spermatids and it localizes exclusively to the cytoplasmic lobe. Immunoelectron microscopy revealed that both cytoplasmic vesicles and the plasma membrane of the cytoplasmic lobe labeled with anti-PM52. During early stages of expression, PM52 appeared to be absent from the head region, but significant PM52 accumulation over the spermatid head was noted in late acrosomal phase spermatids. Throughout spermiogenesis PM52 extended posteriorly to the annulus, which represents a barrier preventing PM52 diffusion into the posterior tail. Following the migration of the annulus to the midpiece-principal piece junction, PM52 began to disappear from the flagellar region and at the completion of spermiogenesis most of the PM52 was restricted to the acrosomal segment. Spermatids and epididymal sperm PM52 exhibited identical sizes by SDS-PAGE and immunoblotting, indicating that they are not proteolytically modified during epididymal maturation. The PM52 antibodies were also used to screen a guinea pig testis cDNA library, and sequence determination of full-length PM52 clones demonstrated identity of a sperm membrane protein recently termed "sperad" (Quill and Garbers, 1996). Membrane barriers and potential mechanisms establishing the domain-specific residence of PM52 are discussed.     

Myc activation reduces fibroblast clonogenicity via an apoptotic mechanism that can be suppressed by a soluble paracrine factor

The bed nucleus of the stria terminalis (BSTL), which is known to be involved in the modulation of stress responses, exhibits a dense network of pituitary adenylate cyclase activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP) immunoreactive (ir) fibers. The origin of the PACAP-ir fibers is unknown, and the origin of the VIP-ir fibers remains uncertain. The most important brain regions connected to the BSTL are the amygdaloid nuclei, the paraventricular and ventromedial hypothalamic nuclei, mesencephalic periaqueductal grey, the dorsal and linear raphe nuclei, the parabrachial nucleus, and the dorsal vagal complex. After microinjecting cholera toxin B subunit (CTB) in the BSTL as a retrograde tracer, neurons were double labeled for CTB and PACAP or VIP immunohistochemistry and the cells from which the PACAP- and VIP-ir fiber networks in the BSTL originated were identified. Cholera toxin B subunit labeled and VIP-ir cells were found in the mesencephalic periaqueductal grey and the dorsal and linear raphe nuclei, but no double labeled cells were seen in the amygdaloid nuclei or the hypothalamic region. CTB- and PACAP-ir neurons were observed in the paraventricular nucleus and the dorsal vagal complex. No double labeled perikarya were seen in the parabrachial nucleus or in the amygdaloid nuclei.     

Thermosensitivity of nuclear RNA polymerase during the in vitro senescence of mouse fibroblasts

Embryonic mouse fibroblasts divide approximately twelve times in vitro prior to cessation of mitotic activity. During this period of cellular senescence the thermosensitivity of the RNA polymerase activity of isolated nuclei has been examined as a means of detecting the possible accumulation of defective enzyme molecules, as has been found by other workers for several cytoplasmic enzymes during the ageing of human fibroblasts in vitro. The total RNA polymerase activity of nuclei isolated from old (10th generation) cells is more thermoresistant than that of young (2nd generation) cells. However, the net RNA polymerase activity of nuclei from non-dividing (confluent) cells is more thermoresistant than that of exponentially growing cells of the same age. When allowance is made for the state of growth of the cultures, little difference is seens in the thermosensitivity of the activities of nuclei from old and young cells. Neither is there any difference between the thermosensitivity of the net activity of an established line of murine fibroblasts (L-cells) and cells in primary culture. Preheating nuclei increases the inhibition of their total RNA polymerase activity by alpha-amanitin, indicating that RNA polymerase II is the most heat resistance species present. There appears to be no difference between the thermosensitivity of the alpha-amanitin sensitive and resistance species of the enzyme in the nuclei of old and young cells. It is concluded that old cells resemble non-dividing young cells in containing a higher proportion of RNA polymerase II in their nuclei, resulting in greater thermoresistance of the total RNA polymerase activity over that of exponentially growing cells. However, there appears to be no increase in thermosensitivity of the enzymes with age.     

Observations on rat Sertoli ectoplasmic ('junctional') specializations in their association with germ cells of the rat testis

The ectoplasmic ('junctional') specialization, a subsurface modification of the Sertoli cell that is often seen facing germ cells, was studied in relation to the development and maturation of these germ cells. This structure is composed of subsurface bundles of filaments and more deeply placed endoplasmic reticulum. The data indicate that these subsurface modifications of Sertoli cells are reutilized in a cyclic fashion, being transferred from their position facing late spermatids to one opposing less mature germ cells. Ectoplasmic specializations appeared to function mechanically in grasping the heads of the spermatids which are undergoing the elongation and maturation phases of spermiogenesis rather than in actually attaching Sertoli cells to these germ cells. It is postulated that the ectoplasmic specialization imparts rigidity to that area of the Sertoli cell that surrounds the head region of the germ cell, forming a recess and a mantle by which the germ cell may be moved toward the base or toward the surface of the seminiferous epithelium. The observed linkage of microtubules to the cisternae of the complex provided a morphological basis for the changes in the cytoarchietecture of the Sertoli cell, which must accompany these movements.     

Proteasome is a carrier to translocate doxorubicin from cytoplasm into nucleus

When an effective concentration of doxorubicin (DXR) was added into L1210 of a mouse leukemia cell line, DXR was rapidly distributed much more in the nuclei than in the other organelle within a few minutes. A [14C]DXR-binding fraction was obtained from the cytosol prepared from L1210 cells. The fraction was adsorbed to hydroxylapatite matrix and eluted from the matrix by 50-150 mM potassium phosphate buffer. The fraction showed high DXR-binding and Suc-Leu-Leu-Val-Tyr-MCA-degrading activity. The binding of [14C]DXR was inhibited by unlabeled DXR. Gel chromatography of the fraction with Sephacryl S-300 separated two fractions of high molecular weight (Peak I, approx. 750 kDa) and low molecular weight (Peak II). Peak I showed proteolytic activity. [14C]DXR-binding Peak I had much higher affinity to DNA-cellulose than [14C]DXR-binding Peak II. [14C]DXR-Peak I complex also was retained into the nuclei isolated from L1210 cells, temperature-dependently. These results suggest that a specific carrier to translocate DXR from cytoplasm into nucleus exists in L1210 cell and the carrier is proteasome.     

Importance of the intracellular domain of NR2 subunits for NMDA receptor function in vivo

The definitive function of pancreatic polypeptide in mammalian physiology remains unknown. The identification of specific PP target tissues should be helpful to further investigations into the possible regulatory actions of this peptide. An in vivo radioreceptor assay was used in the rat to locate potential binding sites of I(125) bovine PP. In vitro, high concentrations of unlabeled hormone competitively inhibit binding to receptors by low concentrations of labeled hormone. In vivo studies showed that, in the presence of concentrated unlabeled pancreatic polypeptide, labeled PP distributes between the plasma and interstitial fluid. When excess unlabeled PP is replaced with saline in the companion animals, the labeled peptide appears to distribute in a volume that exceeds the combined plasma volume and interstitial fluid volume of the tissue. Using this in vivo receptor assay, the distribution volume that exceeds the anatomic extracellular volume has been identified as the receptor compartment. With this assay we demonstrated in the rat specific and displaceable PP binding to the ductus choledochus, duodenum, ileum, and adrenal gland. The NVV determined in the adrenal gland of experimental animals was 3.9 times greater than that found in the control group. Binding was rapid and was displaced only by excess unlabeled pancreatic polypeptide. Neither excess insulin nor excess neuropeptide Y significantly reduced this binding.     

Localization of preganglionic neurons of the accessory ciliary ganglion in the midbrain: HRP and WGA-HRP studies in the cat

Localization of preganglionic neurons of the accessory ciliary ganglion (ACG), including ectopic intraocular ganglion cells, was investigated in the cat with the aid of horseradish peroxidase (HRP) and HRP-conjugated wheat germ agglutinin (WGA-HRP) methods. When HRP or WGA-HRP was injected into the anterior and posterior chambers of the eye, no retrogradely labeled cells were found in the visceral oculomotor nuclei, although most neurons of the ACG and the main ciliary ganglion (CG) were intensely labeled. When a microsyringe needle was inserted into the ciliary body, the tracer diffused into the suprachoroid lamina and the intraocular ganglion cells, and a small number of labeled neurons appeared in the midplane between each side of the somatic oculomotor nuclei. After injection into the ACG, many labeled neurons were observed in the anteromedian nucleus, Edinger-Westphal nucleus, and midplane between the somatic oculomotor nuclei, their ventral continuations of the ventral tegmental area, and the periaqueductal gray. HRP/WGA-HRP injection into the CG labeled cells in all these areas and in the lateral border zones of the anteromedian, Edinger-Westphal and somatic oculomotor nuclei, and their ventral continuations of the ventral tegmental area. These findings indicate that the visceral oculomotor neurons which project to the ACG tend to be located more medially than those to the CG.     

Ribonuclease P from plant nuclei and photosynthetic organelles

RNase P consists of both protein and RNA subunits in all organisms and organelles investigated so far, with the exception of chloroplasts and plant nuclei where no enzyme-associated RNA has been detected to date. Studies on substrate specificity revealed that cleavage by plant nuclear RNase P is critically dependent on a complete and intact structure of the substrate. No clearcut answer is yet possible regarding the order of processing events at the 5' or 3' end of tRNAs in the case of nuclear or chloroplast processing enzymes. RNase P from a phylogenetically ancient photosynthetic organelle will be discussed in greater detail: The enzyme from the Cyanophora paradoxa cyanelle is the first RNase P from a photosynthetic organelle which has been shown to contain an essential RNA subunit. This RNA is strikingly similar to its counterpart from cyanobacteria, yet it lacks catalytic activity. Properties of the holoenzyme suggest an intermediate position in RNA enzyme evolution, with an Eukaryotic-type, inactive RNA and a prokaryotic-type small protein subunit. The possible presence of an RNA component in RNase P from plant nuclei and modern chloroplasts will be discussed, including a critical evaluation of some criteria that have been frequently applied to elucidate the subunit composition of RNase P from different organisms.     

The heterogeneous nuclear RNA of chicken erythroblasts

Heterogeneous nuclear RNA (hnRNA) from chicken erythroblasts has a modal molecular weight of 1.6 -10(6) in 99% dimethylsulfoxide. When erythroblasts are labeled continuously with [14C]uridine, nuclear RNA is labeled as a single kinetic component with a half-life of 18 min. After a 10--20 min lag, label appears in cytoplasmic RNA at about 1% of the initial rate of total RNA synthesis. Of the hnRNA sedimenting faster than 28 S ribosomal RNA in both an aqueous sucrose gradient and a subsequent fructose gradient in 99% dimethylsulfoxide, about one-third is polyadenylated, although only about one in 2000 (i.e. about four molecules per cell) contain a globin messenger sequence. The hnRNA of erythroblasts isolated from 5.7- and 11-day chick embryos have the same content of globin messenger sequences as erythroblaasts from anemic adults.     

Serum 5-nucleotidase and alkaline phosphatase in patients with malignant neoplasms]

The biosynthetic abilities of WI-38 fibroblasts from early and late population-doubling-level cultures were compared by autoradiography of cells grown with labeled precursors of DNA, RNA, protein and lipids. Incorporation of radioactive thymidine, uridine, protein-hydrolysate, acetate, oleic acid and cholesterol, as measured by the number of grains per cell surface, decreased with the progressive aging of the culture. However, the decrease in the incorporation of acetate, oleic acid and cholesterol was much smaller than that of the other precursors, indicating that lipid synthesis is affected to a lesser degree than protein and nucleic acid synthesis on aging. This result is in accord with the higher lipid content and proliferation of intracellular membranes in cells of "old" WI-38 cultures reported by others.     

Studies on the antitesticular action of DL-6-(N-2-pipecolinomethyl)-5-hydroxy-indane (PMHI) in the rat

Both prepubertal and adult rats were treated with a single oral dose of either 60 mg or 120 mg of dl-6-(N-pipecolinomethyl)-5-hydroxy indane maleate (PMHI) per kg of body weight. Their testicular weights were drastically reduced compared with those of the controls. A follow-up, beginning on the third day post-treatment and continuing for a period of 50 days, showed that the body weight growth of PMHI-treated rats was not retarded. The hormonal profile indicated that, except for FSH which showed a transitory elevation in PMHI-treated immature rats, the serum levels of LH, estrogen, and testosterone were indistinguishable from those of the controls. Testicular histology revealed that the spermatogenic process in PMHI-treated rats recovered at a dose-related rate. EM sections of testes of adult rats indicated that cytoplasmic vacuolation appeared in the Sertoli cells 5 h post-treatment. The consequent cascade of arrested spermiogenesis included abnormal acrosomal condensation of spermatids and sloughing of polynucleated spermatids. Some spermatocytes also seemed to be affected, but spermatogonia and Leydig cells remained intact. These results indicate the PMHI acts primarily on Sertoli cells and causes arrest in the spermiogenetic stage of the spermatids. At a higher and toxic dose of PMHI, however, the earlier germinal elements might also be affected, due to the extensive damage to the supporting Sertoli cells.     

Enhanced cytotoxicity with interleukin-1 alpha and 5-fluorouracil in HCT116 colon cancer cells

Recombinant human interleukin-1 alpha (rIL-1 alpha), at concentrations that were not growth-inhibitory when given alone (100-10,000 U/ml), enhanced the growth inhibition resulting from a 72-h fluorouracil (FUra) exposure in HCT116 colon cancer cells. Median-effect analysis of clonogenic assays indicated that rIL-1 alpha, given 24 h prior to and following a 24-h exposure to FUra, increased lethality in a more than additive fashion. rIL-1 alpha did not appear to significantly affect [3H]-FUra metabolism, total [3H]-FUra-RNA incorporation or RNA retention after drug removal, inhibition of thymidylate synthase, or thymidine triphosphate pool depletion. During continuous exposure to rIL-1 alpha, transient stimulation of RNA and DNA synthesis was observed at 72 h, with a return to normal by 96 h. A 24-h exposure to 10 microM FUra altered the elution profile of newly synthesized DNA as monitored by pH step alkaline elution. An accumulation of lower-MW single-stranded DNA species was noted with FUra compared to control, accompanied by a significantly decreased proportion of DNA retained on the polycarbonate filter: 10% retained vs. 32% for control (P = 0.01). A 48-h exposure to rIL-1 alpha alone did not affect the elution profile of nascent DNA species, nor did it enhance the effects of FUra. Although FUra did not appreciably affect pulse [3H]-uridine incorporation into RNA for the initial 8-24 h of FUra exposure, progressive inhibition of net RNA synthesis was observed thereafter. FUra prevented the stimulatory effect of rIL-1 alpha on RNA synthesis, and net RNA synthesis was significantly inhibited (by 64-79% after 72 and 96 h) with the combination compared to rIL-1 alpha alone. Continuous exposure to 10 microM thymidine did not rescue cells from the lethality of FUra alone or the combination of FUra plus rIL-1 alpha, suggesting that depletion of deoxythymidine triphosphate as a consequence of thymidylate synthase inhibition was not the most important component of FUra toxicity. In contrast, 1 mM uridine provided partial protection against the toxicity of FUra alone or with rIL-1 alpha. Although uridine did not affect FUra metabolism, it decreased FUra-RNA incorporation by 42-60%, presumably as a consequence of the 2-fold expansion of UTP pools. [125I]-rIL-1 alpha binding was nonspecific; with a 24-h exposure, however, internalized [125I]-rIL-1 alpha exceeded cell surface-bound material by 2-fold.(ABSTRACT TRUNCATED AT 250 WORDS)     

Endocytosis of androgen-binding protein (ABP) by spermatogenic cells

To test whether Sertoli cell-secreted ABP could serve as steroid carrier to the germ cell (GC) lineage, radiolabeled ABP and SHBG and gold SHBG were used for binding studies and for internalization studies based on transmission electron microscope analyses and autoradiography of the radiolabeled samples. The data clearly showed that: (1) rat and human germ cells possess a single class of binding sites for rat ABP and human SHBG respectively (Kd of 0.78 and 0.56 nM); (2) 1.7 x 10(10) and 2.7 x 10(10) sites/mg protein was found in the corresponding plasma membrane preparations; (3) the receptor peak was eluted in the same position as dextran blue: 2000 kDa (M(r) = 2 x 106) for labeled rat ABP; (4) in the whole GC lineage, the labeled ligand was internalized through an endocytic pathway involving clathrin coated structures and the distribution was similar throughout the maturation step, however striking differences in the internalization rate were revealed with regard to the maturation step; and (5) this internalization occurred even in ligated seminiferous tubules, via the Sertoli cells cytoplasm. When isolated rat GC were incubated in the presence of ABP, a dose dependent increase in labeled secreted protein was observed for spermatocytes (50-250%) whereas ABP had no effect on spermatids. Addition of steroids and ABP caused a 200 and 50% increase in labeled secreted proteins for spermatocytes and spermatids respectively. 2-D SDS-PAGE analysis revealed that ABP alone increased the secretion of specific spermatocyte proteins whereas steroids in the presence of ABP resulted in the synthesis of new spermatocyte secreted proteins. Taken together these results strongly suggest that ABP may be required for spermatogenesis either as a steroid transmembrane carrier or on its own.     

Identification, ontogeny, and regulation of an interleukin-6-like factor in the rat seminiferous tubule

The present study's aims are to search for the presence of interleukin-6 bioactivity (IL-6) in medium conditioned by various testicular cell types and to investigate the cellular and hormonal regulation of testicular IL-6 production. Sertoli cells prepared from rats of increasing ages (20, 35, and 45 days) secreted IL-6 in vitro, whereas medium conditioned by pachytene spermatocytes, early spermatids, and peritubular cells showed no activity. Lipopolysaccharide (LPS) and latex beads, two known stimulators of monocyte/macrophage IL-6 production, markedly stimulated IL-6 secretion by Sertoli cells at all the ages investigated. Maximum levels of IL-6 were reached after 6 h of culture of Sertoli cells with LPS and after 24 h with latex beads. When Sertoli cells were cocultured with pachytene spermatocytes, early spermatids, or fractions containing residual bodies and cytoplasts from elongated spermatids, only the latter significantly stimulated IL-6 levels. Maximum levels of IL-6 were attained by adding 2 x 10(6) residual bodies to Sertoli cells; a significant increase in IL-6 secretion was seen after 6 h, and maximum levels were observed after 24 h. The levels of IL-6 varied throughout different stages of the seminiferous epithelium cycle; highest levels were observed in stages II-VI and lowest in stages VII-VIII. IL-6 bioactivities induced by LPS and residual bodies and cytoplasts from elongated spermatids could be totally neutralized with a specific monoclonal antibody at all of the ages studied. FSH, phorbol myristate acetate, and IL-1 alpha augmented Sertoli cell IL-6 secretion in a dose-dependent manner. Furthermore, FSH and (Bu)2cAMP differentially stimulated IL-6 secretion during the seminiferous epithelial cycle. It is concluded that the release of IL-6 from Sertoli cells is regulated by a complex interplay between residual bodies and humoral factors.