共查询到20条相似文献,搜索用时 15 毫秒
1.
In this study, our goal was to produce a self-assembled layer on a gold electrode that would enable the capture of antibodies orientated for maximum binding to their specific antigen in an immunosensor. To achieve this, the amine groups from lysine residues in protein G were initially converted to thiol groups with 2-iminothiolane. The high affinity of thiols for a gold surface facilitates the direct formation of a self-assembled protein G layer. Following this, the coated gold electrode was exposed to a solution of capture antibody (mAb1) so that these antibodies could attach to the protein G layer through their nonantigenic regions, leaving antigen binding sites available with minimal steric hindrance for binding of target analyte. A comparative study between this method and the more conventional strategy of covalently attaching a layer of nonthiolated protein G on an alkanethiol self-assembled monolayer-coated gold electrode has been performed. Based on a reduced preparation time, and an enhanced capacity for immobilized capture antibody to bind its target analyte due to a more favorable orientation, the layer of thiolated protein G was found to be a more suitable backbone for an electrochemical immunosensor. 相似文献
2.
Sensing systems based on electrochemical detection have generated great interest because electronic readout may replace conventional optical readout in microarray. Moreover, they offer the possibility to avoid labelling for target molecules. A typical electrochemical array consists of many sensing sites. An ideal micro-fabricated sensor-chip should have the same measured values for all the equivalent sensing sites (or spots). To achieve high reliability in electrochemical measurements, high quality in functionalization of the electrodes surface is essential. Molecular probes are often immobilized by using alkanethiols onto gold electrodes. Applying effective cleaning methods on the chip is a fundamental requirement for the formation of densely-packed and stable self-assembly monolayers. However, the available well-known techniques for chip cleaning may not be so reliable. Furthermore, it could be necessary to recycle the chip for reuse. Also in this case, an effective recycling technique is required to re-obtain well cleaned sensing surfaces on the chip. This paper presents experimental results on the efficacy and efficiency of the available techniques for initial cleaning and further recycling of micro-fabricated chips. Piranha, plasma, reductive and oxidative cleaning methods were applied and the obtained results were critically compared. Some interesting results were attained by using commonly considered cleaning methodologies. This study outlines oxidative electrochemical cleaning and recycling as the more efficient cleaning procedure for electrochemical based sensor arrays. 相似文献
3.
As the safety in the food supply becomes critical, the demand for a rapid, low-volume, and sensitive microbial detection device has dramatically increased. A biosensor based on an electrochemical sandwich immunoassay using polyaniline has been developed for detecting foodborne pathogens, such as Escherichia coli (E. coli) O157:H7. The biosensor is comprised of two types of proteins: capture protein and reporter protein. The capture protein is immobilized on a pad between two electrodes, while the reporter protein is attached to conductive polymers. After adding the sample, the target protein binds to the reporter protein and forms a sandwich complex with the capture protein. The conductive polymer that is attached to the reporter protein serves as a messenger, reporting the amount of target protein captured in the form of an electrical signal. The architecture of the biosensor utilizes a lateral flow format, which allows the liquid sample to move from one pad to another by capillary action. Experiments to evaluate the best construction materials, the optimal polyaniline and antibody concentrations, and the distance between electrodes are highlighted in this paper. Results show that the biosensor could detect approximately 7.8/spl times/10/sup 1/ colony forming unit per milliliter of E. coli O157:H7 in 10 min. 相似文献
4.
A novel amperometric biosensor for performing simultaneous electrochemical multianalyte immunoassays is described. The sensor consisted of eight iridium oxide sensing electrodes (0.78 mm(2) each), an iridium counter electrode, and a Ag/AgCl reference electrode patterned on a glass substrate. Four different capture antibodies were immobilized on the sensing electrodes via adsorption. Quantification of proteins was achieved using an ELISA in which the electrochemical oxidation of enzyme-generated hydroquinone was measured. The spatial separation of the electrodes enabled simultaneous electrochemical immunoassays for multiple proteins to be conducted in a single assay without amperometric cross-talk between the electrodes. The simultaneous detection of goat IgG, mouse IgG, human IgG, and chicken IgY was demonstrated. The detection limit was 3 ng/mL for all analytes. The sensor had excellent precision (1.9-8.2% interassay CV) and was comparable in performance to commercial single-analyte ELISAs. We anticipate that chip-based sensors, as described herein, will be suitable for the mass production of economical, miniaturized, multianalyte assay devices. 相似文献
5.
Gergely Márton István Bakos Zoltán Fekete István Ulbert Anita Pongrácz 《Journal of materials science. Materials in medicine》2014,25(3):931-940
The durability of high surface area platinum electrodes during acute intracerebral measurements was investigated. Electrode sites with extremely rough surfaces were realized using electrochemical deposition of platinum onto silicon-based microelectrode arrays from a lead-free platinizing solution. The close to 1000-fold increase in effective surface area lowered impedance, its absolute value at 1 kHz became about 7 and 18 % of the original Pt electrodes in vitro and in vivo, respectively. 24-channel probes were subjected to 12 recording sessions, during which they were implanted into the cerebrum of rats. Our results showed that although on the average the effective surface area of the platinized sites decreased, it remained more than two orders of magnitude higher than the average effective surface area of the original, sputtered thin-film platinum electrodes. Sites with electrochemical deposits proved to be superior, e.g. they provided less thermal and 50 Hz noise, even after 12 penetrations into the intact rat brain. 相似文献
6.
An electrochemical impedance spectroscopy method of detection for aptamer-based array electrodes is reported in which the binding of aptamers immobilized on gold electrodes leads to impedance changes associated with target protein binding events. Human IgE was used as a model target protein and incubated with the aptamer-based array consisting of single-stranded DNA containing a hairpin loop. To increase the binding efficiency for proteins, a hybrid modified layer containing aptamers and cysteamine was fabricated on the photolithographic gold surface through molecular self-assembly. Atomic force microscopy analysis demonstrated that human IgE could be specifically captured by the aptamer and stand well above the self-assembled monolayer (SAM) surface. Compared to immunosensing methods using anti-human IgE antibody as the recognition element, impedance spectroscopy detection could provide higher sensitivity and better selectivity for aptamer-modified electrodes. The results of this method show good correlation for human IgE in the range of 2.5-100 nM. A detection limit of 0.1 nM (5 fmol in a 50-microL sample) was obtained, and an average of the relative standard deviation was <10%. The method herein describes the first label-free detection for arrayed electrodes utilizing electrochemical impedance spectroscopy. 相似文献
7.
Protein chip technology permits analysis of the expression and modification status of numerous targeted proteins within a single experiment, mainly through the use of antibody-based microarrays. Despite recent improvements in these protein chips, their applications are still limited for a variety of reasons, which include technical challenges in fabrication of the antibody chips as well as the very low specificity achieved by current detection methods. We have developed a unique approach for relative and/or absolute quantitation of protein expression and modification based on the capture of epitope peptides on affinity beads, which can be used to develop a mass-spectrometry-based protein chip technology. This new method, which utilizes antibodies immobilized on beads for the capture of target peptides, instead of proteins, eliminates many of the problems previously associated with protein chips. We present here several proof-of-principle experiments examining model peptides by this technique. These experiments show that the method is capable of (i). detecting peptides bound to a single antibody bead, (ii). detecting peptides at low (fmol) levels, (iii). producing MS/MS data of suitable quality for protein identification via database searching or de novo sequencing, (iv). quantitating peptides affinity-bound to antibody beads, (v). specifically detecting target peptides in complex mixtures over wide dynamic ranges, and (vi) is compatible with a microarray format for high-throughput analysis. Because our novel method uses antibody beads instead of a derivatized capture surface, and peptides instead of proteins for affinity capture, it can overcome many of the pitfalls of previous protein chip fabrications. Therefore, this method offers an improved approach to protein chip technology that should prove useful for diagnostics and drug development applications. 相似文献
8.
Self-assembled monolayers (SAMs) of dodecanethiol have been formed on gold electrodes to produce nanoscale defects. These defects define nucleation sites for the electrodeposition of mushroom shaped platinum nanoparticles (PtNPs). The top surfaces of these PtNPs have been selectively functionalized with single stranded probe DNA. These regioselectively modified particles were desorbed by applying a current jump to yield nanoparticles capable of biorecognition on the top curved side and efficient electrocatalysis on the nonfunctionalized lower surface. A second electrode was functionalized with single stranded capture DNA that has a sequence that is complementary to the pathogen, Staphylococcus aureus but leaves a section of the target available to bind the probe strand immobilized on the PtNPs. Following hybridization of the target and capture strands, the surface was exposed to the probe DNA labeled electrocatalytic PtNPs. Target binding was detected by monitoring the current associated with the reduction of hydrogen peroxide in a solution of 0.01 M H(2)SO(4). Calibration plots of the log[DNA] versus faradaic current were linear from 10 pM to 1 μM and picomolar concentrations could be detected without the need for amplification of the target, for example, using PCR or NASBA. As well as a wide dynamic range, this detection strategy has an excellent ability to discriminate DNA mismatches and a high analytical sensitivity. 相似文献
9.
A novel nanogap fabrication method using an electrochemical nanopatterning technique is presented. Electrochemical deposition of platinum ions reduces the microgap size to the sub-50-nm range due to the self-limited volume expansion of the electrodes. Additionally, the low crystallinity of platinum reduces the line edge roughness in the electrodes, whereas the high crystallinity of gold increases it. Current compliance, a buffered resistor, and a symmetric deposition strategy are used to achieve high reliability and practicality of nanogap electrodes. As a possible application, an organic thin-film transistor using the nanogap electrodes is also demonstrated. 相似文献
10.
Sydor JR Scalf M Sideris S Mao GD Pandey Y Tan M Mariano M Moran MF Nock S Wagner P 《Analytical chemistry》2003,75(22):6163-6170
A new chip-based method to identify protein-protein interactions was developed using the guanine nucleotide exchange factor GRF2 and two interacting proteins, Ras and calmodulin, as model proteins. A generic immobilization strategy for FLAG-tagged bait proteins on a protein-repellent streptavidin chip surface was implemented by presentation of an oriented anti-FLAG antibody. A flow cell device, integrating different chip surfaces, was developed, and the interaction of immobilized GRF2 with the two analytes was verified by fluorescence assays. On-chip tryptic digest assays were then performed on the capture surface and analyzed by microLC-MS/MS. The interaction of GRF2 with calmodulin and Ras was demonstrated, and the lower limit of detection was determined. We also implemented an on-chip immunoprecipitation assay to identify GRF2-binding partners from complex protein mixtures. Cells overexpressing FLAG-GRF2 were lysed and then incubated with the anti-FLAG chip. In addition to detecting GRF2, we also identified calmodulin, demonstrating that this technique can successfully identify endogenous levels of proteins, bound to recombinant bait proteins. This chip-based method has the advantage that no subsequent gel separations of protein complexes prior to LC-MS analysis are required and is therefore amenable to miniaturized high-throughput determination of protein-protein interactions. 相似文献
11.
Magnetic electrochemical immunoassays with quantum dot labels for detection of phosphorylated acetylcholinesterase in plasma 总被引:2,自引:0,他引:2
A new magnetic electrochemical immunoassay has been developed as a tool for biomonitoring exposures to organophosphate (OP) compounds, e.g., insecticides and chemical nerve agents, by directly detecting organophosphorylated acetylcholinesterase (OP-AChE). This immunoassay uniquely incorporates highly efficient magnetic separation with ultrasensitive square wave voltammetry (SWV) analysis with quantum dots (QDs) as labels. A pair of antibodies was used to achieve the specific recognition of OP-AChE that was prepared with paraoxon as an OP model agent. Antiphosphoserine polyclonal antibodies were anchored on amorphous magnetic particles preferably chosen to capture OP-AChE from the sample matrixes by binding their phosphoserine moieties that were exposed through unfolding the protein adducts. This was validated by electrochemical examinations and enzyme-linked immunosorbent assays. Furthermore, antihuman AChE monoclonal antibodies were labeled with cadmium-source QDs to selectively recognize the captured OP-AChE, as characterized by transmission electron microscopy. The subsequent electrochemical SWV analysis of the cadmium component released by acid from the coupled QDs was conducted on disposable screen-printed electrodes. Experimental results indicated that the SWV-based immunoassays could yield a linear response over a broad concentration range of 0.3-300 ng/mL OP-AChE in human plasma with a detection limit of 0.15 ng/mL. Such a novel electrochemical immunoassay holds great promise as a simple, selective, sensitive, and field-deployable tool for the effective biomonitoring and diagnosis of potential exposures to nerve agents and pesticides. 相似文献
12.
Aptamer-based rolling circle amplification: a platform for electrochemical detection of protein 总被引:3,自引:0,他引:3
Aptamer-based rolling circle amplification (aptamer-RCA) was developed as a novel versatile electrochemical platform for ultrasensitive detection of protein. This method utilized antibodies immobilized on the electrode surface to capture the protein target, and the surface-captured protein was then sandwiched by an aptamer-primer complex. The aptamer-primer sequence mediated an in situ RCA reaction that generated hundreds of copies of a circular DNA template. Detection of the amplified copies via enzymatic silver deposition then allowed enormous sensitivity enhancement in the assay of target protein. This novel aptamer-primer design circumvented time-consuming preparation of the antibody-DNA conjugate for the common immuno-RCA assay. Moreover, the detection strategy based on enzymatic silver deposition enabled a highly efficient readout of the RCA product as compared to a redox-labeled probe based procedure that might exhibit low detection efficiency due to RCA product distance from the electrode. With the platelet-derived growth factor B-chain (PDGF-BB) as a model target, it was demonstrated that the presented method was highly sensitive and specific with a wide detection range of 4 orders of magnitude and a detection limit as low as 10 fM. Because of the wide availability of aptamers for numerous proteins, this platform holds great promise in ultrasensitive immunoassay. 相似文献
13.
To detect the target molecules, aptamers are currently focused on and the use of aptamers for biosensing is particularly interesting, as aptamers could substitute antibodies in bioanalytical sensing. So this paper describes the novel electrochemical system for protein in sandwich manner by using the aptamers and the scanning electrochemical microscope (SECM). For protein detection, sandwich system is ideal since labeling of the target protein is not necessary. To develop the electrochemical protein sensor system, thrombin was chosen as a target protein since many aptamers for it were already reported and two different aptamers, which recognize different positions of thrombin, were chosen to construct sandwich type sensing system. In order to obtain the electrochemical signal, the glucose oxidase (GOD) used for labeling the detection aptamers since it has large amount of stability in aqueous solution. One aptamer was immobilized onto the gold electrode and the other aptamer for detection was labeled with GOD for generation of the electric signal. Thrombin was detected in sandwich manner with aptamer immobilized onto the gold electrode and the GOD labeled aptamer. The enzymatic signal, generated from glucose addition after the formation of the complex of thrombin, was measured. The generation-collection mode of SECM was used for amperometric H2O2 detection. 相似文献
14.
Wilson MS 《Analytical chemistry》2005,77(5):1496-1502
The microfabrication of electrochemical immunosensors for the simultaneous detection of two protein analytes is described. The sensors consisted of two iridium oxide electrodes (1-mm diameter) patterned on a glass substrate. Capture antibodies were immobilized on the porous iridium oxide electrodes by covalent attachment using (3-aminopropyl)triethoxysilane and glutaraldehyde. The spatial separation of the electrodes (2.5 mm) enabled simultaneous electrochemical immunoassays to be conducted without cross-talk between the electrodes. Proteins were measured using electrochemical ELISA, and detection was achieved by electrochemically oxidizing alkaline phosphatase-generated hydroquinone. Sensors for the simultaneous detection of goat IgG and mouse IgG, and for the tumor markers CEA and AFP, were developed. The sensors had detection limits of 1, 2, 1.2, and 1 ng/mL for goat IgG, mouse IgG, CEA, and AFP, respectively. 相似文献
15.
Combining positive attributes of planar arrays and suspension arrays, immobilized particle arrays offer a new format in which immobilized submicrometer particles are arrayed on hydrogel-coated slides, providing 100+ assay replicates within each spot. This research describes how to prepare immobilized protein arrays and how to assay the binding of labeled target molecules to the arrayed capture probes. The assay system exhibits an intrinsic dynamic range of two to three decades, with coefficients of variation from 5 to 10%. For antibody-antigen binding, target capture appears to be reaction rate limited. For labeled antibody binding to antigen on the immobilized particles, the detection limit is approximately 0.5 ng/mL. When antibodies on the immobilized particles exhibit multivalent binding of target molecules, the detection limit is approximately 0.01 ng/mL. For protein arrays, potential advantages of this format are improved coating of the capture reagent, an increased number of options for protein presentation, reduced mass transport effects, and higher density multiplexing. 相似文献
16.
Antibody arrays hold considerable potential in a variety of applications including proteomics research, drug discovery, and diagnostics. Many of the schemes used to fabricate the arrays fail to immobilize the antibodies at a uniform density or in a single orientation; consequently, the immobilized antibodies recognize their antigens with variable efficiency. This paper describes a strategy to immobilize antibodies in a single orientation, with a controlled density, using the covalent interaction between cutinase and its suicide substrate. Protein fusions between cutinase and five antibodies of three different types (scFv, V(HH), and FN3) were prepared and immobilized upon self-assembled monolayers (SAMs) presenting a phosphonate capture ligand. The immobilized antibodies exhibit high affinity and selectivity for their target antigens, as monitored by surface plasmon resonance and fluorescence scanning. Furthermore, by changing the density of capture ligand on the SAM the density of the immobilized antibody could be controlled. The monolayers, which also present a tri(ethylene glycol) group, are inert to nonspecific adsorption of proteins and allow the detection of a specific antigen in a complex mixture. The demonstration of cutinase-directed antibody immobilization with insert SAMs provides a straightforward and robust method for preparing antibody chips. 相似文献
17.
Aptamers are artificial oligonucleotides that have been widely employed to design biosensors (i.e., aptasensors). In this work, we report a microfluidic electrochemical aptamer-based sensor (MECAS) by constructing Au-Ag dual-metal array three-electrode on-chip for multiplex detection of small molecules. In combination with the microfluidic channels covering on the glass chip, different targets are transported to the Au electrodes integrated on different positions of the chip. These electrodes are premodified by different kinds of aptamers, respectively, to fabricate different sensing interfaces which can selectively capture the corresponding target. It is an address-dependent sensing platform; thus, with the use of only one electrochemical probe, multitargets can be recognized and detected according to the readout on a corresponding aptamer-modified electrode. In the sensing strategy, the electrochemical probe, [Ru(NH(3))(6)](3+) (RuHex), which can quantitatively bind to surface-confined DNA via electrostatic interaction, was used to produce chronocoulometric signal; Au nanoparticles (AuNPs) were used to improve the sensitivity of the sensor by amplifying the detection signals. Moreover, the sensing interface fabrication, sample incubation, and electrochemical detection were all performed in microfluidic channels. By using this detection chip, we achieved the multianalysis of two model small molecules, ATP, and cocaine, in mixed samples within 40 min. The detection limit of ATP was 3 × 10(-10) M, whereas the detection limit of cocaine was 7 × 10(-8) M. This Au-Ag dual metal electrochemical chip detector integrated MECAS was simple, sensitive, and selective. Also it is similar to a dosimeter which accumulates signal upon exposure. It held promising potential for designing electrochemical devices with high throughput, high automation, and high integration in multianalysis. 相似文献
18.
A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished. 相似文献
19.
A microfluidic chip that integrates all the fluidic components of a gradient liquid chromatography (LC) system is described. These chips were batch-fabricated on a silicon wafer using photolithographic processes and with Parylene as the main structural material. The fabricated chip includes three electrolysis-based electrochemical pumps, one for loading the sample and the other two for delivering the solvent gradient; platinum electrodes for delivering current to the pumps and establishing the electrospray potential; a low-volume static mixer; a column packed with silica-based reversed-phase support; integrated frits for bead capture; and an electrospray nozzle. The fabricated structures were able to withstand pressures in excess of 250 psi. The device was used to perform a liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis of a mixture of peptides from the trypsin digestion of bovine serum albumen (BSA). Gradient elution through the 1.2-cm column was performed at a flow rate of 80 nL/min. Compared to the analysis of the same sample using a commercial nanoflow LC system, the chromatographic resolution was nearly as good, and the total cycle time was significantly reduced because of the minimal volume between the pumps and the column. Results demonstrate the potential of mass-produced, low-cost microfluidic systems capable of performing LC separations for proteomics applications. 相似文献
20.
An optical label-free biosensing platform for bacteria detection ( Escherichia coli K12 as a model system) based on nanostructured oxidized porous silicon (PSiO(2)) is introduced. The biosensor is designed to directly capture the target bacteria cells on its surface with no prior sample processing (such as cell lysis). The optical reflectivity spectrum of the PSiO(2) nanostructure displays Fabry-Pe?rot fringes characteristic of thin-film interference, enabling direct, real-time observation of bacteria attachment within minutes. The PSiO(2) optical nanostructure is synthesized and used as the optical transducer element. The porous surface is conjugated with specific monoclonal antibodies (immunoglobulin G's) to provide the active component of the biosensor. The immobilization of the antibodies onto the biosensor system is confirmed by attenuated total reflectance Fourier transform infrared spectroscopy, fluorescent labeling experiments, and refractive interferometric Fourier transform spectroscopy. We show that the immobilized antibodies maintain their immunoactivity and specificity when attached to the sensor surface. Exposure of these nanostructures to the target bacteria results in "direct cell capture" onto the biosensor surface. These specific binding events induce predictable changes in the thin-film optical interference spectrum of the biosensor. Our preliminary studies demonstrate the applicability of these biosensors for the detection of low bacterial concentrations. The current detection limit of E. coli K12 bacteria is 10(4) cells/mL within several minutes. 相似文献