Relation between nocturnal decline in blood pressure and mortality. The Ohasama Study

To investigate the relation between nocturnal decline in blood pressure and mortality, we obtained ambulatory blood pressures in 1542 residents aged 40 years or over of a rural Japanese community. Subjects were followed-up for a mean of 5.1 years and were then subdivided into four groups according to the percent decline in nocturnal blood pressure: 1) extreme dippers: percent decline in nocturnal blood pressure > or = 20% of the daytime blood pressure; 2) dippers: decline of > or = 10% but < 20%; 3) nondippers: decline of > or = 0% but < 10%; and 4) inverted dippers: no decline. The relationship between the decline in nocturnal blood pressure and mortality was examined by the Cox proportional hazards regression model adjusted for age, sex, smoking status, previous history of cardiovascular disease, and the use of antihypertensive medication. The mortality risk was highest in inverted dippers, followed by nondippers. There was no difference in mortality between extreme dippers and dippers. This relationship was observed for both treated and untreated subjects, was more pronounced for cardiovascular than for noncardiovascular mortality, and did not change after the data were adjusted for 24-h, daytime, and nighttime blood pressure levels.     

Sol–gel preparation of photosensitive fluorinated inorganic–organic thin films for printing plates

A photosensitive inorganic–organic thin film is prepared by a sol–gel method from nylon, N,N′-methylenebisacrylamide, tetraethoxysilane, 3-methacryloxypropyltrimethoxysilane, and 2-perfluorooctylethyltrimethoxysilane (17F) for use as a printing plate medium. A single-layered coating film containing fluorine formed on an aluminum substrate exhibits much higher rubbing durability than existing silicone-based plates, and a low surface free energy of 16.5 mJ m⁻² despite the low 17F content. The surface of the thin film was characterized by contact angle measurements, X-ray photoelectron spectroscopy, Fourier transform infrared spectroscopy, and scanning electron microscopy. These analyses reveal that the mechanism of ink repellency on the printing plate was the migration of the fluorinated component to the surface of the thin film.     

Synthesis and Characterization of Dialkyl-C61

Three-step synthesis from dialkyl ketone (R₂C=O) with C₆₀ gave C₆₀(CR₂)_n [R = Me, Et, Pr, Bu, (CH₂)₅.; n = 1, 2]. The adducts were isolated by means of gel permeation chromatography, and the monoadducts were characterized by ¹H and/or ¹³C NMR spectroscopies as a mixture of major [5, 6] and minor [6, 6] isomers. Their solubility and electrochemical properties were reported.     

CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.     

Manufacturing process and material characteristics of Ag-Ni contacts consisting of nickel-compounded particles

Using a high-speed, high-shear mill, particle surfaces of Ag-Ni alloy in which Ni is finely dispersed in the Ag matrix were coated and compounded with Ni powder. Particles thus compounded can be processed into a wire. Post-processing compounded Ni forms a fibrous texture on the wire longitudinal section and a network on the cross-section. This characteristic metallurgical structure improves the contact performance (fusion and wear resistances).     

Development of Ag Alloy Thin Film With Both High Reflectance and Adhesion for High Density Opt-Electronic Module

We have developed a new multilayered reflection film structure containing Ag films for achieving slab waveguide based optical transmission interconnections between large scale integrated chips for next generation high-speed computers. We applied Cr to both adhere the Ag to the SiO₂ optical layer and to inhibit diffusion of Ag into SiO₂. Although we found that Cr tends to decrease the reflectance, we found that it is possible to satisfy both adhesiveness and reflectance requirements by adjusting the film thickness     

Predominant localization of non-specific lipid-transfer protein of the yeast Candida tropicalis in the matrix of peroxisomes

PXP-18 is a 14-kDa major peroxisomal protein of the yeast Candida tropicalis and a homologue of the non-specific lipid-transfer protein (nsLTP) of mammals. Mammalian nsLTP is thought to facilitate the contact of membranes, to stimulate lipid-transfer between them. If PXP-18 functions like nsLTP, it must be present on organelle membranes. Immunoelectron microscopy of C. tropicalis cells indicated that gold particles, which visualized PXP-18, localized exclusively in the matrix of peroxisomes. Subcellular fractionation followed by Western blotting revealed the association of PXP-18 with peroxisomes in C. tropicalis cells. An enzyme-linked immunosorbent assay revealed that almost all the PXP-18 associated with peroxisomes was detectable after the solubilization of the organelle but not before, implying the predominance of PXP-18 inside peroxisomes. This differential assay was applied to the intracellular import of the intact and truncated PXP-18s expressed in Saccharomyces cerevisiae cells. Most of the intact PXP-18 was shown to be imported into the matrix of host-cell peroxisomes, whereas the truncated PXP-18, which lacked the C-terminal tripeptide Pro-Lys-Leu, no longer targeted peroxisomes. These results are consistent with the view that PXP-18 is the matrix protein of peroxisomes and must function in a system other than that of lipid transfer.     

Lack of survival benefit of extended lymph node dissection for ductal adenocarcinoma of the head of the pancreas: retrospective multi-institutional analysis in Japan

It has not been established that extended lymph node resection is necessary for ductal adenocarcinoma of the head of the pancreas. According to the general rules for the study of pancreatic cancer, a multiinstitutional, retrospective clinical study was undertaken to investigate the efficiency of extended lymph node dissection for this malignancy. Altogether 501 patients underwent resection of the pancreas between 1991 and 1994 at 77 medical facilities; the surgical procedures, staging, lymph node dissection, curability, and survival rate were analyzed retrospectively. Eighteen of the patients died within 30 postoperative days, leaving 483 patients to be studied. The resection was curative microscopically in 94 patients, resulting in a 3-year survival of 29%. Macroscopically curative resection resulted in a 3-year survival of 14%; noncurative resection produced a 3-year survival of 6%. Although extended lymph node dissection was performed on 38 patients in stage I, 42 patients in stage II, 206 patients in stage III, and 1 patient in stage IV, there was no improvement in survival when the results were compared to those seen after standard or palliative lymph node dissection. The extent of lymph node dissection has not affected the prognosis for ductal adenocarcinoma of the head of the pancreas at any stage of the course of the disease. Excessive lymph node dissection in advanced cases does not necessarily lead to a favorable prognosis. The patients who undergo a radical operation with an adequate lymph node dissection have longer survivals.     

Inhibition by taurine of the inwardly rectifying K+ current in guinea pig ventricular cardiomyocytes

Effects of taurine on the inwardly rectifying K+ current (IK1) in isolated guinea pig ventricular cardiomyocytes were examined using patch voltage-clamp methods. All experiments were performed at 36 degrees C. Taurine (10-20 mM) increased the action potential duration, but failed to affect the resting potential. Holding potential was maintained at -30 mV. The current was activated with an inwardly going rectification, and was completely blocked by Ba2+ (2 mM). Taurine inhibited IK1 at - 120 mV by 28.3+/-1.1% (n=6, P < 0.05) at 10 mM and by 36.0+/-2.1% (n=6, P < 0.01) at 20 mM. The reversal potential was shifted in the hyperpolarizing direction by 3.7+/-0.6 mV (n=6) at 20 mM. In inside-out patch-clamp experiments, the amplitude of unitary channels was -2.7+/-0.3 pA (n=21) at -90 mV. Symmetrical high-K+ (150 mM) solutions in both bath and pipette were used. The channel conductance was 32+/-2 pS (n=9). Taurine did not affect channel conductance, but markedly decreased the open probability at - 120 mV of channel by 21.5+/-2.4% (n=8, P < 0.01) at 10 mM, and by 56.7+/-3.8% (n=8, P < 0.001) at 20 mM. These responses were almost reversible. These results suggest that taurine directly modulates the open probability of the inwardly rectifying K+ current, resulting in regulation of the functions of heart cells.