Conversion of microwave pyrolysed ASR's char using high temperature agents

Pyrolysis enables to recover metals and organic feedstock from waste conglomerates such as: automotive shredder residue (ASR). ASR as well as its pyrolysis solid products, is a morphologically and chemically varied mixture, containing mineral materials, including hazardous heavy metals. The aim of the work is to generate fundamental knowledge on the conversion of the organic residues of the solid products after ASR's microwave pyrolysis, treated at various temperatures and with two different types of gasifying agent: pure steam or 3% (v/v) of oxygen. The research is conducted using a lab-scale, plug-flow gasifier, with an integrated scale for analysing mass loss changes over time of experiment, serving as macro TG at 950, 850 and 760 °C. The reaction rate of char decomposition was investigated, based on carbon conversion during gasification and pyrolysis stage. It was found in both fractions that char conversion rate decreases with the rise of external gas temperature, regardless of the gasifying agent. No significant differences between the reaction rates undergoing with steam and oxygen for char decomposition has been observed. This abnormal char behaviour might have been caused by the inhibiting effects of ash, especially alkali metals on char activity or due to deformation of char structure during microwave heating.     

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.     

The Flow-Shop Problem with Mean Completion Time Criterion

This paper discusses the mean flow-time flow-shop problem. Several new properties have been developed that provide the reader with a better understanding of this model. A class of solvable cases is defined that includes the known solvable cases.     

Microstructure and formation mechanism of complex chromium diffusion layer

Presentation of a new type of chromium diffusion layer obtained on 0.5 % C carbon steel by termit process. Microstructure, phase composition and chemical composition of the layer obtained after various chromizing conditions. Determination of the growth mechanism of layer based on Fe-Cr-C equilibrium diagrams.     

Data errors in the computation of free motion

Input data in the computation of free motion (the inertia and stiffness matrices) contain some errors. These errors generate errors of output data (the natural frequency vector, the natural mode vectors). In this paper the relationships between errors of input and output data in the computation of free motion are derived. This analysis is applied to the finite element method. The paper presents program ERROR, which computes the errors of the natural frequencies created by the inertia matrix errors. An example of the influence of the errors of the mass and of the mass moment of inertia on the natural frequencies of a ship hull is presented.     

A novel extraction method for peanut allergenic proteins in chocolate and their detection by a liposome-based lateral flow assay

In this study, conditions for extracting the major peanut allergen (Ara h1) from chocolate were optimized, and the extracted samples were analyzed by a lateral flow assay (LFA) using liposomal nanovesicles. The optimal conditions using peanut-spiked chocolate were found to be extraction with a mixture of phosphate buffered saline and hexane for 30 min at 35 °C. After centrifugation, the buffer portion was treated with insoluble poly(vinylpolypyrrolidone) to remove phenolic compounds, and then analyzed by the LFA. The entire analysis, including sample preparation and LFA, could be easily completed within 2 h, and the detection limit was 158 g of peanuts/g of chocolate.     

The Influence of Oxide Scale on Heat Transfer during Reheating of Steel

The present work presents methodology and development of a mathematical model for prediction of the influence of oxide scale on heat transfer during reheating of steel in an industrial furnace. In this developed model, temperatures inside the steel billet were measured and with thermocouples at selected places and were collected by a water cooled computer that was traveling inside the slab. CFD is used to calculate the flow field inside of a furnace. The mass‐transfer coefficient of the scale formation is obtained by solving the convection mass‐diffusion equation across a boundary layer to the surface of a flat plate. A model for inverse heat conduction is employed to calculate the local surface temperature and heat flux on top of the growing oxide scale layer on a slab moving through a walking beam reheating furnace. By using the inverse method, the transient temperature and heat flux was firstly determined on the surface of the steel. During subsequent computations, the growth of the scale was calculated and the surface temperature of the oxide scale was extracted by using the Cauchy data from the previous calculations. The sensibility of the model on steel physical parameters is studied, and suitable parameters were obtained for heating a low carbon steel plate in the reheating furnace. Results show that the oxide scale layer should not be neglected in reheating models.     

The Effect of Liquid Crystalline Structures on Antiseizure Properties of Aqueous Solutions of Ethoxylated Alcohols

Aqueous solutions of ethoxylated alcohols which form lyotropic liquid crystals at high concentrations (40–80%) were selected as model lubricating substances. Microscopic studies under polarized light and viscosity measurements were carried out in order to confirm the presence of liquid crystalline structures in the case of alcohol solutions with ethoxylation degrees of 3, 5, 7 and 10. Microscopic images and viscosity coefficient values characteristic of various mesophases were obtained. As expected, the viscosity of LLCs decreases considerably with an increase in shearing rate which is characteristic of liquid crystals being non-Newtonian liquids. Antiseizure properties were determined by means of a four-ball machine (T-02 Tester) and characterized by scuffing load (P_t), seizure load (P_oz) and limiting pressure of seizure (p_oz). Alcohol ethoxylates forming mesophases in aqueous solutions have the strongest effect on the P_t values which are several times higher than those measured in the presence of water. Ethoxylates with higher degrees of ethoxylation exhibit higher values of scuffing load. Those changes have been interpreted as a result of higher cloud points at which those compounds lose their amphiphilic properties. In general, the presence of mesophases in the bulk phase and particularly in the surface phase may lead to the formation of a lubricant film which separates the frictionally cooperating elements of a friction pair. The antiseizure efficiency of alcohol solutions is highest up to the load value which does not exceed the scuffing load value.