Analysis of dissertations on the diagnosis and treatment of gynecologic diseases that were defended in the Russian Federation and accepted by the Russian Federation Higher Certifying Committee

Ten years experience of the polyplatillene clinical application and experimental study is summarized. Results of treatment of 689 inner organs cancer patients stage IV, I-IV clinical groups. The advantages of polyplatillene versus others platinum group chemopreparations are shown. Manufacturing difficulties, mistakes and perils of the preparation application are pointed out. The direct dose-dependence of results is shown. Possibilities of polyplatillene application in biotechnology, radiology, virusology as a regulator of the cell division, viral replication and their interaction with a cell is shown.     

Flow cytometry in cervical adenocarcinoma. Correlating DNA content analysis with the clinical picture

A case is presented in which prolonged resuscitation and rewarming was performed following post-rescue cardiopulmonary arrest in severe immersion hypothermia. The rescue and resuscitation techniques necessary to optimise outcome in such cases are described.     

Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.     

Selenium as a modifier of antioxidant protection and lipid peroxidation in microclones of Arnica montana L. as affected by C-range ultraviolet rays

selenium was studied for its effect on the node components of antioxidant protection of plants irradiated by UV of C-range. It is shown that selenium modifies the UV action of C-range and decreases the oxidation of SH-groups, increases activity of superoxide dismutase and glutathione peroxidase and decreases the accumulation of the end product of peroxidation: malondialdehyde.     

Relationship between onset of puberty and establishment of persistent infection with equine arteritis virus in the experimentally infected colt

The relationship between stage of reproductive tract maturity and susceptibility to the experimental establishment of persistent infection with equine arteritis virus (EAV) was investigated in 21 prepubertal and 15 peripubertal colts. Five of six prepubertal colts inoculated intranasally remained infected in the reproductive tract from post-challenge day 28 to 93 and two of six from post-challenge day 120 to 180. No virus was detected in five of these animals killed on post-challenge day 210. Each of two peripubertal colts remained infected in the reproductive tract at post-challenge day 60 and one of nine was found to be persistently infected with EAV 15 months after challenge. These findings confirm that the virus can replicate in the reproductive tract of a significant proportion of colts for a variable period of time after clinical recovery in the absence of circulating concentrations of testosterone equivalent to those found in sexually mature stallions. Long-term persistent infection with EAV does not appear to occur in colts exposed to the virus before the onset of peripubertal development. We suggest that colts should be vaccinated at approximately 6 months of age, before peripubertal development but after the disappearance of maternally acquired antibodies.     

Carcinoma of the stomach with hepatocyte differentiation (hepatoid adenocarcinoma)

A case of hepatoid adenocarcinoma of the stomach is reported, and the literature is reviewed. The stomach is one of the most common sites in which hepatoid adenocarcinomas have been detected. Of the 59 cases reviewed from the literature (including the current case), a 2:1 male predominance was noted, and the serum alpha-fetoprotein level was almost always increased. All patients were adults, and most had evidence of metastases at the time of resection. Prognosis seems less favorable than that associated with the more common intestinal type of adenocarcinoma of the stomach. Hepatoid adenocarcinomas typically show periodic acid-Schiff-positive, diastase-resistant intracytoplasmic globules, which are demonstrated to be positive with antibodies to alpha-fetoprotein. The tumor cells resemble liver cells, and rare cases, including our own, have evidence of bile production. In our case, messenger RNA for albumin, unique to liver cells, was demonstrated by in situ hybridization of the tumor cells.