Thermal stability of the immobilization process of horseradish peroxidase in electrospun polymeric nanofibers

The horseradish peroxidase enzyme (type VI 250 U mg^?1) was encapsulated in polymeric nanofibers using the electrospinning technique and successfully immobilized by the exposure to glutaraldehyde (GA) vapor in order to create covalent bonds between the polyivinilalcohol (PVA) polymeric chains and the enzyme molecules. The morphology of the nanofibers was analyzed by scanning electron microscopy (SEM) showing a diameter in the range of 100–200 nm. The presence of the enzyme in the electrospun nanofibers was confirmed by infrared spectroscopy (FTIR). The optimum crosslinking time was 1 h of exposure to GA vapor. The maximum percentage of the retained protein and the enzyme activity was obtained using the lowest initial enzyme concentration. The enzyme activity of the sample was retained after four reuse cycles. Differential scanning calorimetry (DSC) was used to study the thermal stability of the samples. The thermal study of the immobilized HRP enzyme provide for the first time additional information regarding the interaction of the HRP enzyme molecules with the PVA chains of the nanofiber matrix, as well as the effect of the crosslinking time in the glass transition temperature and the heat of fusion of the samples. © 2017 Wiley Periodicals, Inc. J. Appl. Polym. Sci. 2017 , 134 , 44811.     

Phytosterol Esterification is Markedly Decreased in Preterm Infants Receiving Routine Parenteral Nutrition

Several studies reported the association between total plasma phytosterol concentrations and the parenteral nutrition‐associated cholestasis (PNAC). To date, no data are available on phytosterol esterification in animals and in humans during parenteral nutrition (PN). We measured free and esterified sterols (cholesterol, campesterol, stigmasterol, and sitosterol) plasma concentrations during PN in 16 preterm infants (500–1249 g of birth weight; Preterm‐PN), in 11 term infants (Term‐PN) and in 12 adults (Adult‐PN). Gas chromatography–mass spectrometry was used for measurements. Plasma concentrations of free cholesterol (Free‐CHO), free phytosterols (Free‐PHY) and esterified phytosterols (Ester‐PHY) were not different among the three PN groups. Esterified cholesterol (Ester‐CHO) was statistically lower in Preterm‐PN than Adult‐PN. Preterm‐PN had significantly higher Free‐CHO/Ester‐CHO and Free‐PHY/Ester‐PHY ratios than Adult‐PN (Free‐CHO/Ester‐CHO: 1.1 ± 0.7 vs. 0.6 ± 0.2; Free‐PHY/Ester‐PHY: 4.1 ± 2.6 vs. 1.3 ± 0.8; *P < 0.05). Free‐CHO/Ester‐CHO and Free‐PHY/Ester‐PHY ratios of Term‐PN (Free‐CHO/Ester‐CHO: 1.1 ± 0.4; Free‐PHY/Ester‐PHY: 2.9 ± 1.7) were not different from either Preterm‐PN or from Adult‐PN. Plasma Free‐CHO/Ester‐CHO and Free‐PHY/Ester‐PHY were unchanged after 24 h on fat‐free PN both in Preterm‐PN and in Adult‐PN. Free‐PHY/Ester‐PHY did not correlate with phytosterol intake in Preterm‐PN. Free‐PHY/Ester‐PHY of Preterm‐PN was positively correlated with the Free‐CHO/Ester‐CHO and negatively correlated with gestational age and birth weight. In conclusion, PHY were esterified to a lesser extent than CHO in all study groups; the esterification was markedly decreased in Preterm‐PN compared to Adult‐PN. The clinical consequences of these findings warrant further investigations.     

Facile Handling of 3D Two-Photon Polymerized Microstructures by Ultra-Conformable Freestanding Polymeric Membranes

Micro-nano-fabrication on objects with complex surfaces is essential for the development of technologies in the growing fields of flexible electronics and photonics. Various strategies are devised to extend the fabrication from conventional planar substrates to curved ones, however, significant challenges still exist, especially in the framework of 3D printing and additive manufacturing. In this study, a novel technique is presented to realize 3D micro-structures on arbitrary complex surfaces providing an extreme level of conformability. This method relies on the fabrication of micro-structures via two-photon polymerization on polymeric nano-membranes that can be efficiently transferred to a specific target. Ultra-thin polymeric films are exploited as the support to suspend and transfer the printed micro-structures on the predefined surface. The nanofilm can finally be easily removed, apart from the region underneath the printed elements where it serves as a few tens of nanometers adhesive. The repeatability and feasibility of the proposed process are investigated and shown to provide large flexibility of choice on the printed structures, materials used, transfer procedures, and targeted substrate geometries. By integration with standard fabrication processes, the described technique offers a great potential for the development of next-generation multidimensional/multi-material micro-nano-technologies.     

An algorithm for the structural analysis of state space: synthesis of nonlinear observers

The problem addressed is the linearization of multi‐input multi‐output (MIMO) nonlinear systems by a generalized state coordinates transformation and generalized input–output injection, in order to design an observer. This observer will have linear error dynamics. The goal is to bring together two observers design approaches: a structural one and a numerical one. Necessary and sufficient conditions for the existence of a linearizing generalized state transformation are obtained by an algebraic way and without computing the input–output differential equations. The main result tests integrability conditions of differential one‐forms derived from the state space representation and is applicable to a large subclass of nonlinear systems. Copyright © 2001 John Wiley & Sons, Ltd.     

Load Testing of a Closed-Ended Pipe Pile Driven in Multilayered Soil

Piles are often driven in multilayered soil profiles. The accurate prediction of the ultimate bearing capacity of piles driven in mixed soil is more challenging than that of piles driven in either clay or sand because the mechanical behavior of these soils is better known. In order to study the behavior of closed-ended pipe piles driven into multilayered soil profiles, fully instrumented static and dynamic axial load tests were performed on three piles. One of these piles was tested dynamically and statically. A second pile served as reaction pile in the static load test and was tested dynamically. A third pile was tested dynamically. The base of each pile was embedded slightly in a very dense nonplastic silt layer overlying a clay layer. In this paper, results of these pile load tests are presented, and the lessons learned from the interpretation of the test data are discussed. A comparison is made of the ultimate base and limit shaft resistances measured in the pile load tests with corresponding values predicted from in situ test-based and soil property-based design methods.     

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (A^Br), 8-oxo-2′-deoxyadenosine (A^oxo) or β-L-2′-deoxyadenosine (A^L) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an A^L residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.     

Arteriovenous fistula: end‐to‐end or end‐to side anastomosis?

The purpose of the present study was to compare the end‐to‐end (ETEa) with the end‐to‐side (ETSa) anastomosis in patients starting hemodialysis by means of radio‐cephalic artero‐venous fistulae (AVF). In our experience, we compared the results, as early failure (EF), late thrombosis (LT), stenosis, steal syndrome, and primary patency (PP), in 2 groups of hemodialysis incident patients that had been placed an AVF by means of ETEa or ETSa. The observation period lasted 24 months for each of the 2 types of AVF, starting from October 2005 to September 2007 for ETEa and from October 2007 to September 2009 for ETSa. One hundred forty patients were included in the present study. We have consecutively performed 99 AVF interventions at the wrist or at the third distal of the forearm, in 70 patients by means of ETEa and 82 AVF interventions in the same anatomical places in 70 patients by means of ETSa. The patients with ETEa had a mean age of 64.4 ± 14.6 years, males were 65.8% and the age dialysis at the end of observation was 10.4 ± 5.7 months. Those with ETSa had a mean age of 65.9 ± 15.5 years and the males were 62.9%, the age dialysis at the end of observation was 9.2 ± 5.5 months. The surgical team was composed by the same nephrologists. The statistical study was performed by means of the χ chi‐square and Fisher's exact test. We have observed more late thrombosis (10% vs. 4.1%) and stenosis (21.4% vs. 2.7%) in ETEa than in ETSa. The number of early thrombosis was similar in the 2 types of anastomosis. The primary patency 1‐year rate was better though not significantly in the ETS (80% vs. 85.7%) In our experience the ETSa provides, overall better results, both regarding the complications and primary survival than ETEa. For the benefits that seem to come from it, we believe, that a broad ETSa in the distal native AVF is preferable to the ETEa.     

Dose dependence and fading effect of the thermoluminescence signals in γ-irradiated paprika

The thermoluminescence (TL) method can be used to discriminate irradiated and non-irradiated paprika. This study reports the polymineral composition of the dust adhered to paprika; radiation-specific luminescence is emitted by the inorganic material (mainly quartz, feldspars and calcite). On the basis of the shape of the TL curves (or glow curves) some physical parameters are evaluated. Natural TL curves, from non-irradiated samples, show three very low intensity peaks while induced TL curves, from irradiated paprika, seem to consist of five overlapping peaks. TL spectra reveal a very important difference in intensity and in the position of the peaks between irradiated and non-irradiated paprika. Fading observations of TL after irradiation at 5, 10 and 21 kGy, show the same behaviour in all the cases: an initial rapid decay to maintain a certain stability from 300–400 h onwards. © 1998 SCI.     

3D Micropatterned Functional Surface Inspired by Salvinia Molesta via Direct Laser Lithography for Air Retention and Drag Reduction

Bioinspired functional surfaces are attracting increasing interest in surface engineering, mostly in the field of wettability. The Salvinia-effect is a remarkable example of superficial air retention and drag force reduction caused by selective chemical coating (super-hydrophobic wax and hydrophilic dead cells) and peculiar 3D hierarchical morphological structures. The replication of Salvinia-like patterns at the microscale has always been prevented by limitations in microfabrication techniques, thus hindering relevant technological applications at this dimensional scale. Integrating 3D laser lithography and traditional microfabrication techniques, dimensionally downscaled, 3D micropatterned surfaces inspired for the first time by both morphology and chemical coating of the hairs present on the Salvinia Molesta leaves are reproduced. The effect of design and different surface energies (bare hydrophilic, hydrophobic, selective hydrophilic/hydrophobic coating) on the wettability are modeled and investigated. Bioinspired surfaces demonstrated to be super-hydrophobic in terms of apparent static contact angle (up to 170°) and provide tunable adhesion with roll-off angle from less than 10° to 90°. They successfully proved remarkable underwater air retention capability, sustained by stable Cassie-Baxter state under external hydrostatic pressure up to 4 atm. The proposed surfaces are tested in hydrodynamic conditions: drag force reduction is successfully demonstrated with up to 40% of energy saved.     

Decoupled Power Allocation Through Pricing on a CDMA Reverse Link Shared by Energy-Constrained and Energy-Sufficient Data Terminals

We perform market-oriented management of the reverse link of a CDMA cell populated by data terminals, each with its own data rate, channel gain, willingness to pay (wtp), and link-layer configuration, and with energy supplies that are limited for some, and inexhaustible for others. For both types of energy budgets, appropriate performance indices are specified. Notably, our solution is “decoupled” in that a terminal can choose optimally, irrespective from choices made by the others, because it pays in proportion to its fraction of the total power at the receiver, which directly determines its signal-to-interference ratio (SIR), and hence its performance. By contrast, in other similarly-sounding schemes terminals’ optimal choices are interdependent, which leads to “games of strategy”, and their practical and theoretical complications. We study two situations: pricing for maximal (i) network revenue, and (ii) social benefit. The socially-optimal price is common to all terminals of a given energy class, and an energy-constrained terminal pays in proportion to the square of its power fraction. By contrast, the revenue-maximising network sets for each terminal an individual price that drives the terminal to the “revenue per Watt” maximiser. The network price is higher, and drives each terminal to consume less. Distinguishing features of our model are: (i) the simultaneous consideration of both limited and unlimited energy supplies, (ii) the performance metrics utilised (one for each type of energy supply), (iii) the generality of our physical model, which can lead to an optimal link-layer configuration, and (iv) our pricing of the received power fraction which yields a “decoupled” solution.