Pneumatic reduction of intussusception using carbon dioxide

Pneumatic reduction using air has recently become popular for the initial non-surgical management of intussusception. Since carbon dioxide (CO2) is rapidly absorbed from body surfaces, it should theoretically result in less cramping and distension following reduction. We reviewed our recent experience with the pneumatic reduction of intussusception using CO2 in 26 children. In 22 of these the intussusception was reduced (85%). There was one performation with CO2; the patient did not suffer any postoperative complications. Five additional children who had been treated unsuccessfully with barium had intussusception subsequently reduced with CO2. Following CO2 reduction, most children were fed within hours, and there were no instances of significant abdominal distension or cramping. We conclude that pneumatic reduction of intussusception using CO2 is safe and effective, and has the theoretical advantage of more rapid absorption from the gastrointestinal tract than air.     

Activation of procarcinogens by human cytochrome P450 enzymes expressed in Escherichia coli. Simplified bacterial systems for genotoxicity assays

Bacterial assays were used to examine the activation of 14 known procarcinogens by cytochrome P450 (P450) enzymes. Human P450s 1A1, 1A2 and 3A4 were expressed in Escherichia coli with slight modification of their N-terminal sequences. Genotoxicity was measured by the induction of the SOS response in Salmonella typhimurium NM2009 (TA1535/pSK1002/pNM12), which contains a umuC regulatory sequence attached to the lacZ reporter gene. Conditions for analysis were examined using E. coli membranes and purified enzymes. Membrane fractions, fortified with NADPH-P450 reductase, were found to be useful preparations for measuring activation of the procarcinogens. Conditions of linearity were established for these assays and the systems were applied to several particular problems related to bioactivation of procarcinogens by P450s. The patterns of activation of the 14 individual chemicals were consistent with the literature developed using human liver microsomes, purified liver P450s and other approaches. The P450s expressed in bacterial membranes could be inhibited by antibodies. 7,8-Benzoflavone inhibited P450s 1A1 and 1A2 and stimulated P450 3A4 in the membranes. The contributions of P450s 1A1 and 1A2 were distinguished with some of the arylamines and 7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene. Recombinant P450 3A4 was found to be more active than P450 1A2 in the activation of aflatoxin B1 at all substrate concentrations examined.     

Involvement of IL-16 in the induction of airway hyper-responsiveness and up-regulation of IgE in a murine model of allergic asthma

Experiments were designed to investigate the role of IL-16 in a mouse model of allergic asthma. OVA-sensitized mice were repeatedly exposed to OVA or saline aerosols. Bronchoalveolar lavage fluid (BALF) was collected after the last aerosol, and the presence of IL-16 was evaluated using a migration assay with human lymphocytes. Migration of lymphocytes was significantly increased in the presence of cell-free BALF from OVA-challenged mice compared with BALF from saline-challenged controls. This response was significantly inhibited after addition of antibodies to IL-16, demonstrating the presence of IL-16 in BALF of OVA-challenged animals. Immunohistochemistry was performed and revealed IL-16 immunoreactivity particularly in airway epithelial cells but also in cellular infiltrates in OVA-challenged mice. IL-16 immunoreactivity was absent in nonsensitized animals; however, some reactivity was detected in epithelial cells of sensitized but saline-challenged mice, suggesting that sensitization induced IL-16 expression in airway epithelium. Treatment of mice with antibodies to IL-16 during the challenge period significantly suppressed up-regulation of OVA-specific IgE in OVA-challenged animals. Furthermore, antibodies to IL-16 significantly inhibited the development of airway hyper-responsiveness after repeated OVA inhalations, whereas the number of eosinophils in bronchoalveolar lavage or airway tissue was not affected. In conclusion, IL-16 immunoreactivity is present in the airways after sensitization. After repeated OVA inhalation, IL-16 immunoreactivity is markedly increased and IL-16 is detectable in BALF. Furthermore, IL-16 plays an important role in airway hyper-responsiveness and up-regulation of IgE but is not important for eosinophil accumulation in a mouse model of allergic asthma.     

Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.     

Absence of Epstein-Barr virus (EBV) in a gastrointestinal stromal cell tumour (GIST) in an adult human immunodeficiency virus-seropositive patient with past EBV infection

Gastrointestinal stromal cell tumours (GIST) of the small intestine are rare malignancies. Recently, an association of Epstein-Barr virus (EBV) with malignant stromal cell tumour in young people with AIDS and past EBV infection has been described. We describe a 33-year-old heterosexual male with asymptomatic human immunodeficiency virus (HIV) infection who had had an EBV infection in the past and who presented with an EBV-negative GIST. The association between EBV and malignant stromal cell tumours in young people with AIDS could not be reconfirmed in our adult patient. The relationship between EBV and malignant stromal cell tumours in AIDS patients and the possible pathogenetic role of EBV remains to be established, at least in adults.     

Amniocentesis before 14 completed weeks as an alternative to transabdominal chorionic villus sampling: a controlled trial with infant follow-up

Plasma cortisol, prolactin, oestrogen, progesterone, thyroxine, thyrotrophin (TSH) were collected from 23 pregnant, 70 postpartum women at 7 days postpartum, and 38 non-gravid controls. Sixty two postpartum women were screened for depression by the Edinburgh Postnatal Depression Scale (EPDS) on day 7 after delivery and 34 of them were assessed by the Present State Examination (PSE) at 8 +/- 2 weeks after delivery. Postpartum women had a significantly greater level of cortisol, prolactin, thyroxine and oestrogen than non-puerperal women. Postpartum women with current depression (EPDS > or = 11) had significantly lower plasma prolactin levels than those without depression and those who developed depression within 6-10 weeks after delivery (PSE level > or = 5) had significantly lower plasma prolactin and significantly greater progesterone levels than those who were not depressed. There were significant correlations between age and plasma cortisol and prolactin levels. Higher thyroxine levels predicted greater severity of concurrent symptoms of depression (total EPDS score) whilst higher progesterone and lower prolactin levels predicted the occurrence of depression (total PSE score) 6-10 weeks after delivery. Women who breastfed had significantly lower EPDS and total PSE scores and higher plasma prolactin levels than those who did not breastfed their infants whilst women who had previous episodes of depression had significantly greater EPDS and PSE scores, lower prolactin and higher TSH levels than those who had not suffered from previous episodes of depression.     

Glycated cholecystokinin-8 has an enhanced satiating activity and is protected against enzymatic degradation

Monoglycated cholecystokinin octapeptide (CCK-8) (glucitol-Asp1 adduct) modified at the NH2-terminus was prepared under hyperglycemic conditions, purified by high-performance liquid chromatography, and characterized by mass spectrometry (Mr 1228.4 Da) and peptide sequencing. CCK-8 (100 nmol/kg, i.p.) significantly (P < 0.001) reduced voluntary food intake of fasted mice for up to 30 min after its administration, compared with saline-administered controls. Glycated CCK-8 reduced food intake at 30-120 min (P < 0.01 to P < 0.001) and significantly reduced feeding compared with CCK-8 from 60 to 120 min (P < 0.01). In vitro plasma degradation studies indicated that glycated CCK-8 was resistant to the normal rapid enzymatic conversion to CCK fragments. This study demonstrated that CCK-8 is a potent short-term inhibitor of food intake, and that structural modification of this peptide by amino-terminal glycation leads to enhanced satiating activity, partially due to increased resistance to serum aminopeptidase degradation.     

Fatty acid synthase expression in endometrial carcinoma: correlation with cell proliferation and hormone receptors

BACKGROUND: Fatty acid synthase (FAS), a biosynthetic enzyme, normally functions in the liver to convert dietary carbohydrate to fat, but it is minimally expressed in most other normal adult tissues. FAS is expressed at markedly elevated levels in subsets of human breast, ovarian, and prostate carcinomas that are associated with poor prognoses. During the menstrual cycle, the expression of FAS in the human endometrium is closely linked to the expression of the proliferation antigen Ki-67, estrogen receptor (ER), and progesterone receptor (PR). METHODS: This study reports the expression patterns of these antigens in 35 endometrial carcinomas as determined by immunohistochemical analysis. RESULTS: All cases demonstrated a close direct correlation between FAS and Ki-67 expression. Average FAS expression levels were correlated with tumor grade. Twenty-five carcinomas that were positive for ER and PR showed close correlation in expression of FAS, Ki-67, and hormone receptors. Individual tumors displayed varying degrees of heterogeneity of expression. A few well-differentiated carcinomas showed very low expression of all four antigens, similar to the antigenic profile of secretory endometrium. Nine high grade carcinomas that were negative for ER and PR also showed close correlation in expression of FAS and Ki-67 with uniformly high expression. CONCLUSIONS: These data suggest the following hypothesis: In hormone-dependent endometrial cells, FAS expression is part of the estrogen-driven cellular response that leads to proliferation; however, its linkage to proliferation is such that FAS expression is maintained in proliferating cells in endometrial carcinomas that acquire hormone independence. The use of these four antibodies as a panel may increase the diagnostic utility of ER and PR immunohistochemistry for tumor classification and prediction of the responsiveness of tumors to hormonal therapy.     

Effects of hydration on tactile sensation

The routine tasks of washing usually necessitates the immersion of parts of the body in water, which causes hydration and changes in the mechanical properties of the superficial layer of skin. To determine how hydration affects tactile sensations, the hydration and skin-surface temperature of glabrous and hairy skin was first measured under normal conditions (air), after submersion in distilled water alone and after submersion in a surfactant-water solution. In these experiments, measurements were made of the time to achieve complete hydration and the recovery time to normal levels. The uptake of water in hairy skin was found to be considerably greater than in glabrous skin, and retention was significantly prolonged by the surfactant additive. Subsequent experiments on glabrous skin, based on the results of the preceding hydration studies, measured in-air and hydrated tactile thresholds and sensation magnitudes to vibratory stimuli and to the roughness of textured surfaces. Vibrotactile detection thresholds were not affected by skin hydration, nor were sensation magnitudes to suprathreshold vibratory stimuli. However, suprathreshold perceptions of roughness were substantially altered by hydration. It is concluded that hydration and the mechanics of the skin play a major role in the perception of spatiotemporal (i.e., textured) surfaces and, thus, must be taken into account in any physiological/psychophysical model based on using such stimuli. This may not be required for models based on predominantly temporal (i.e., vibratory) stimuli.