排序方式: 共有454条查询结果,搜索用时 15 毫秒
381.
Carbohydrate adaptive substance for prophylaxis of immune disorders and correction of dysbacterioses
GV Vikha NN Liz''ko VI Korol''kov MP Rykova DO Meshkov AA Sukhno OA Poletaeva VN Frolov NI Bevz IuV Gordeev 《Canadian Metallurgical Quarterly》1998,32(4):21-25
Effects of a new preparation, adaptokhit, on the intestinal microbiocenosis and some parameters of immune resistance were studied in Macaque rhesus during 13-day hypokinesia. Experimental animals were given adaptokhit as an alimentary supplement preventing dysbiotic consequences of the microecologic unbalance due to motor restraint. Results of the investigation showed certain distinctions in the intestinal microflora in the experimental and control animals as early as on day three of the experiment. Intestinal microflora of the experimental primates who daily consumed adaptokhit at 50 mg/kg of the body remained stable throughout the period of observation. In contrast, in their controls lactoflora was found to decrease in parallel to the growth of opportunistically pathogenic endobacteria including representatives of Proteus and Clostridia sp., and development of dysbacteriosis of categories II and III. Besides, in the experimental animals adaptokhit prevented decline in the proliferative activity of lymphocytes further into adaptation. Also, at the final stage of observation following canceling the preparation there were signs of normalization of the allergologic status of primates in the experimental group. Therefore, adaptokhit can be used as an alimentary supplement to strengthen the colony resistance of animals in extreme conditions. 相似文献
382.
TB Muradnazarova ZA Tedzhenova ON Borodina OA Konnova AD Shukurov OA Iazkurbanova GN Berdyklycheva RZ Rakhimova ZF Kravets 《Canadian Metallurgical Quarterly》1998,70(11):42-43
AIM: The study of clinical symptoms of gastrointestinal lesions in subjects invaded with cryptosporidia. MATERIALS AND METHODS: From 1994 to 1997 383 patients with monocryptosporidiasis were observed. 75.7% of them were children. Cryptosporidia oocysts were identified in fecalia using Fulleborn technique. The specimens were stained according to Cill-Nilsson. RESULTS: Clinically, the invasion was characterized by acute onset, severe course in children, involvement of the whole gastrointestinal and respiratory tracts. CONCLUSION: Monocryptosporidiasis runs in Turkmenistan a more severe course compared to countries with moderately hot climate. 相似文献
383.
Antigens that were specific to Fasciola gigantica were obtained from the whole worm homogenate of the parasite by immunoaffinity chromatography in cyanogen bromide-activated sepharose 4B columns and used for the production of monoclonal antibodies. The F. gigantica-specific monoclonal antibody was labelled with horseradish peroxidase and used for the detection of circulating antigen by the direct ELISA method in the sera of cattle experimentally infected with the parasite. Circulating antigens were detectable in the sera of the animals as from the third week after infection while negative absorbance values were obtained 2 weeks after the termination of the infection by chemotherapy with oxyclozanide. This immunodiagnostic method offers an attractive alternative as a supplement to the conventional coprological diagnosis of fasciolosis. 相似文献
384.
OA al-Rawas R Carter RD Stevenson SK Naik DJ Wheatley 《Canadian Metallurgical Quarterly》1997,12(3):471-8; discussion 478-9
OBJECTIVE: The pulmonary transfer factor for carbon monoxide (TLCO) has been reported to decline following heart transplantation, but the time course of this decline is not well documented. The aim of this study was to define the longitudinal changes in TLCO after heart transplantation. METHODS: Single breath TLCO, lung volumes and expiratory flow rates were prospectively measured in 57 patients (mean age 49 years, range 19-61) before and at least once after heart transplantation. Thirty seven of the 57 patients had four post-transplant assessment which were performed at 6 weeks, 3, 6 and 12 months in 26 patients and at 12, 18, 24 and 36 months in 11 patients. Results were compared with data from 28 normal subjects (mean age 40 years, range 19-61). RESULTS: Before transplantation there was a mild impairment of lung volumes and expiratory flow rates. At 6 weeks after transplantation, there was a further reduction in the forced expiratory volume in one second, forced vital capacity, residual volume and total lung capacity, but all of these increased in the subsequent measurements to exceed their pre-transplant values at about 1 year after transplantation. Haemoglobin-corrected TLCO was also reduced before transplantation compared to normal controls (74.3% and 98.6% of predicted respectively, P < 0.001). Although TLCO per unit alveolar volume (KCO) was relatively preserved in heart transplant candidates, it was still significantly lower than that of normal controls (92.6% and 105.3% of predicted respectively, P < 0.05). After transplantation, mean haemoglobin-corrected TLCO and KCO declined by 12% and 20% of predicted respectively) with the majority of patients having reductions greater than 10% of predicted. The decline in TLCO and KCO was evident at 6 weeks after transplantation with no further changes in the subsequent measurements. CONCLUSIONS: TLCO is reduced in heart transplant candidates and declines further after heart transplantation despite improvement in lung volumes and airway function. The early and non-progressive nature of TLCO decline suggests an aetiology exerting its effect on TLCO within the first 6 weeks after transplantation. 相似文献
385.
AG Pokrovski? OA Pliasunova VM Blinov VV Vlasov FP Svinarchuk TV Abramova VV Gorn DA Konevets 《Canadian Metallurgical Quarterly》1993,27(5):1039-1043
Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II. 相似文献
386.
1. Nitric oxide (NO) plays an important role in the control of glomerular haemodynamics and is synthesized from the amino acid L-arginine by a family of enzymes, NO synthase (NOS). 2. Nitric oxide synthase is present in the endothelium and also in the macula densa, a plaque of specialized tubular epithelial cells. Endothelial NOS is known to be stimulated by shear stress and hormones, while the factor that regulates the activity of macula densa NOS remains undefined. 3. Studies with the in vitro microperfusion of glomerular arterioles have shown that the constriction of afferent arterioles (Af-Art) induced by myogenic responses and angiotensin II (AngII) is stronger in the absence rather than in the presence of luminal flow. Furthermore, endothelial disruption or NOS inhibition abolishes such differences, suggesting that flow through the lumen stimulates the endothelium to synthesize and release NO, which in turn attenuates both the myogenic response and the action of AngII in the Af-Art. 4. In contrast, NOS inhibitors have no effect on efferent arteriolar (Ef-Art) constriction induced by AngII. 5. In preparations in which Af-Art and the macula densa are simultaneously microperfused, selective inhibition of macula densa NOS has been shown to augment Af-Art constriction when the NaCl concentration at the macula densa is high, suggesting that the macula densa produces NO, which in turn modulates tubuloglomerular feedback. 6. Thus, the differential actions of NO in the Af-Art, Ef-Art and the macula densa may be important in the control of glomerular haemodynamics under various physiological and pathological conditions. 相似文献
387.
Antibodies to an axolemma-enriched fraction (AEF) antigen have been detected in the cerebrospinal fluid (CSF) and serum of patients with Multiple Sclerosis (MS) using an enzyme-linked immunosorbent assay (ELISA). A marginal elevation (P < 0.08) of anti-AEF IgG was found in MS CSF when compared with OND samples. When CSF was diluted to a standardized IgG concentration, the anti-AEF IgG level in MS CSF was significantly elevated (P=0.007) when compared to OND CSF. MS serum was also found to contain a significantly higher level (P < 0.001) of anti-AEF IgG when compared to OND serum using the ELISA technique. 相似文献
388.
The purpose of this study was to evaluate retrospectively outcomes of the Mau osteotomy for hallux abducto valgus deformity. Twenty-two patients were evaluated by the senior author on an average of 14 months (range, 3-34 months) following their surgery. Preoperative and postoperative intermetatarsal (IM) and hallux abductus (HA) angles were evaluated as well as range of motion of the first metatarsophalangeal joint and patient satisfaction. The mean preoperative IM and HA angles were 16.1 degrees and 35.8 degrees. The mean reduction in IM and HA angles was 10.5 degrees and 23.5 degrees, respectively. Joint range of motion was 58 degrees of dorsiflexion (range, 42 degrees-80 degrees) and 11 degrees of plantarflexion (range, 0 degree-20 degrees). There were no cases of delayed healing or avascular necrosis. There were two patients (9%) with radiographic values consistent with hallux varus; however, neither patient had a clinical appearance of hallux varus and neither patient was displeased with the outcome. Ninety-one percent of patients returned to a soft shoe or sneakers in an average of 5.1 weeks following surgery. Eighty-two percent of patients had no pain at the time of their evaluation, and 96% of patients stated they were satisfied or very satisfied with the surgery. Comparing the subgroup of patients who underwent a Mau-Reverdin procedure with another subgroup undergoing a Mau-Reverdin fibular sesamoidectomy, there was a 3.7 degrees greater reduction of IM angle and 6.7 degrees greater reduction in HA angle in the subgroup with the fibular sesamoidectomy. 相似文献
389.
390.
R Carter OA al-Rawas RD Stevenson SK Naik DJ Wheatley 《Canadian Metallurgical Quarterly》1998,92(4):628-632
In contrast to the standard single-breath transfer factor for carbon monoxide (TLCO), there are no specific guidelines or recommendations for the measurement of its components, the pulmonary capillary blood volume (VC) and membrane component (DM), by the Roughton and Forster method. Ten randomly selected heart transplant patients (three life-long non-smokers, seven ex-smokers > 1 yr, age range 24-55 years) were assessed on two occasions using either the standard or high-oxygen mixture as the first inspired gas in random order. Ten normal subjects (all non-smokers, age range 23-54 years) were assessed on two occasions using either a long protocol (30 min waiting time between repeat measurements in an individual set) or a short protocol (5 min waiting time). Two technically acceptable results of TLCO were used to derive a mean value for DM and VC for each set of measurements (Transflow, P. K. Morgan, Kent, U.K.). The different sequences of gas mixtures produced no significant differences between the values obtained in ten heart transplant patients for mean TLCO (mmol min-1 kPa-1) (standard first 5.13 +/- 1.15, high-oxygen first 5.14 +/- 1.12; limits of agreement -0.57 to 0.59 for DM or for VC. The long or short protocol produced no significant differences between the means of TLCO (mmol min-1 kPa-1) (long 8.0 +/- 1.9, short 8.0 +/- 1.9; limits of agreement -0.5 to 0.5), DM or VC. This allows the development of a standard test protocol of short duration (about 40 min) making it practical for clinical use without compromising the precision or reproducibility of the results obtained. 相似文献