Reaction to effect the transformation of anionic polymerization into cationic polymerization: 3. Analysis of block copolymer formation by gel permeation chromatography

A study of the g.p.c. traces of AB poly(styrene-bTHF) materials prepared by anion-to-cation transformation reactions has established conditions under which very narrow molecular weight distributions may be obtained. Dispersities as low as 1.04 were consistently obtained using directly brominated polystyrenes as initiators, and there is evidence that this value is an upper limit controlled by machine broadening. Dispersities of about 1.15 were registered with block copolymers prepared from xylylene-bromide-terminated polystyrenes, but in neither system was there any evidence for a chain scission process to generate homo polyTHF.     

Transplanted neural tissue develops connections with host rat brain

Superior collicular fragments transplanted from fetal to newborn rat brains develop complex internal organization and receive visual afferents from the host providing they lie sufficiently close to the host visual pathways. This system allows investigation in vivo of special affinities between cells of the mammalian central nervous system.     

Second virial coefficients of polybenzyl methacrylate near the theta point

Technical urea-formaldehyde resins are almost completely demethylolated on heating with alcaline earth hydroxydes. Higher methylene-bridged oligomers and partially crosslinked materials are precipitated. Methylol groups are not quantitatively removed, as methylolated lower molecular weight oligomers are still present in the aqueous solution. The major amount of liberated formaldehyde is irreversibly converted to hexoses by aldolization.     

Sequence from the assembly nucleation region of TMV RNA

In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.     

Hypoxanthine-guanine phosphoribosyltransferase mutant glioma cells: diminished monamine oxidase activity

A defective capability of cultured rat glioma cells to reutilize purine bases (hypoxanthine-guanine phosphoribosyltransferase deficiency) was associated with a reduced capacity to oxidatively deaminate serotonin and tryptamine. The mutant glioma cells were also more sensitive to the cytotoxic effects of serotonin than were normal cells     

Effects of information feedback and self-administered consequences on self-monitoring study behavior.

Self-monitoring involves systematic self-observation followed by self-recording. Three hypotheses were tested in this experiment: (a) the previous finding that that self-monitoring changes study behavior would be replicated; (b) information feedback accounts for some of this behavior change; and (c) this behavior change can be enhanced by manipulating the quantity and quality of information feedback and self-administered consequences associated with self-monitoring. 87 volunteer college students concerned about their study habits were randomly assigned to a no-treatment control group, a study skills advice group, or 1 of 6 self-monitoring plus study skills advice groups. The design included a no-contact control group of 9 nonvolunteers. Grade, questionnaire, and self-monitoring data clearly support the 1st 2 hypotheses, but not the 3rd. The 2nd hypothesis was supported by the finding that students lacking accurate information about the extent (i.e., amount) of their study behavior benefited more from self-monitoring than those who were already knowledgeable about their study behavior. (20 ref) (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

Use of organ cultures of animal trachea and lung for studying respiratory viruses

Organ cultures of the trachea and the lungs of newborn guinea pigs, rabbits, chickens, cow and pig embryos supported multiplication of influenza A2 and adenovirus type 3 viruses. Trachea organ cultures were shown to be more sensitive to the viruses under study. Organ cultures of the chicken trachea can be used for diagnosis of respitaroy virus infections.